Messages

1

w3DNA -- web interface to 3DNA / Re: changing secondary structure to tertiary structure of ssDNA

« on: April 04, 2012, 04:11:05 am »

Hi Xiang Jun,

I have been going through your web and also the software tutorial. But I still can't find a solution of creating the DNA hairpin at the top and the tail at the end and joining these two with the duplex.  Do you have any suggestions on how to do it?

Kumutha

2

w3DNA -- web interface to 3DNA / changing secondary structure to tertiary structure of ssDNA

« on: March 22, 2012, 04:09:27 am »

Hi Xiang Jun,

I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na⁺ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.

How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance

Kumutha

3

General discussions (Q&As) / 3DNA download

« on: March 21, 2012, 01:15:51 am »

Hi,

Where can I get a latest downloadable software tutorial?

4

General discussions (Q&As) / Re: Problems with installing 3DNA on MinGW/MSYS

« on: March 20, 2012, 11:30:15 pm »

Thank you. 

5

General discussions (Q&As) / Problems with installing 3DNA on MinGW/MSYS

« on: March 20, 2012, 09:59:53 pm »

Hi,

 Is it possible to install 3DNA software on windows XP? If so, how do I do it?  should I install MinGW or Cygwin?