Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.8.0 (DSSR Manual) · Homepage

Topics - kumutha

Pages: [1]
1
Hi Xiang Jun,

I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na+ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.

How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance :)

Kumutha

2
General discussions (Q&As) / 3DNA download
« on: March 21, 2012, 01:15:51 am »
Hi,

Where can I get a latest downloadable software tutorial?

3
Hi,

 Is it possible to install 3DNA software on windows XP? If so, how do I do it?  should I install MinGW or Cygwin? 

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University