Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage · HIRING!

Messages - kumutha

Pages: [1]
1
Hi Xiang Jun,

I have been going through your web and also the software tutorial. But I still can't find a solution of creating the DNA hairpin at the top and the tail at the end and joining these two with the duplex.  Do you have any suggestions on how to do it?

Kumutha

2
Hi Xiang Jun,

I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na+ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.

How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance :)

Kumutha

3
General discussions (Q&As) / 3DNA download
« on: March 21, 2012, 01:15:51 am »
Hi,

Where can I get a latest downloadable software tutorial?

4
Thank you.  :)

5
Hi,

 Is it possible to install 3DNA software on windows XP? If so, how do I do it?  should I install MinGW or Cygwin? 

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University