Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.4 (DSSR Manual) · Homepage

Author Topic: changing secondary structure to tertiary structure of ssDNA  (Read 148691 times)

Offline kumutha

  • with-posts
  • *
  • Posts: 5
    • View Profile
changing secondary structure to tertiary structure of ssDNA
« on: March 22, 2012, 04:09:27 am »
Hi Xiang Jun,

I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na+ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.

How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance :)

Kumutha

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1743
    • View Profile
    • 3DNA homepage
Re: changing secondary structure to tertiary structure of ssDNA
« Reply #1 on: March 22, 2012, 10:52:29 am »
Hi Kumutha,

Thanks for posting the DNA sequence and its beautiful secondary structure predicted with mfold. 3DNA per se, and the 3DNA server based on it, does not have the magic (yet) to directly convert such a secondary structure into tertiary structure. However, I do believe 3DNA has functionality to help solve some components of the puzzle. In your case, the long double-helical stem can be approximated with a fiber B-DNA model; then you need to model the loop part at the top and the two terminal nucleotides at the bottom end. You need to assemble the three parts together, and possibly perform some energy minimization to achieve good stereochemistry.

You may find the article "RNA-Puzzles: A CASP-like evaluation of RNA three-dimensional structure prediction" published in the April 2012 [18 (4)] issue of the RNA journal helpful.

Xiang-Jun
« Last Edit: March 22, 2012, 10:55:24 am by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline kumutha

  • with-posts
  • *
  • Posts: 5
    • View Profile
Re: changing secondary structure to tertiary structure of ssDNA
« Reply #2 on: April 04, 2012, 04:11:05 am »
Hi Xiang Jun,

I have been going through your web and also the software tutorial. But I still can't find a solution of creating the DNA hairpin at the top and the tail at the end and joining these two with the duplex.  Do you have any suggestions on how to do it?

Kumutha

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1743
    • View Profile
    • 3DNA homepage
Re: changing secondary structure to tertiary structure of ssDNA
« Reply #3 on: April 04, 2012, 07:36:52 am »
See my previous reply. In short, 3DNA is not directly up to your purpose yet, even though some of its components may be useful in certain part of your workflow. The recent "RNA-Puzzles" paper in the RNA journal is the state-of-the-art on predicting DNA/RNA tertiary structures.

Good luck with your project.

Xiang-Jun
« Last Edit: April 04, 2012, 09:32:14 am by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University