Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Messages - tctcab

Pages: [1]
1
RNA structures (DSSR) / Re: modified nucleotides incorrect.
« on: February 05, 2020, 10:13:05 pm »

Many thanks for your time!

I find DSSR to be handy and really like your work and your devotion to maintaining it for so long.

2
RNA structures (DSSR) / Re: modified nucleotides incorrect.
« on: February 04, 2020, 07:26:53 pm »
Hi, Xiang-Jun,

Thanks for your explanation, now I understand your choice.

However, regarding 1ASY_R and PSU, the basepair classification of DSSR would be:

command: x3dna-dssr -i=1ASY_R.pdb --json -o=1ASY_R.dssr.json

pairs:
...
       index      nt1      nt2  bp       name   Saenger  LW DSSR
28    28   R.C631   R.G639 C-G         WC    19-XIX cWW cW-W
29    29 R.PSU632   R.C638 P-C         --       n/a cWW cW-W
30    30 R.PSU632   R.G639 P-G         --       n/a cWW cW-W
...

You should notice the inconsistency between BP classification. briefly, the name, Saenger columns do not recognize the WC pair of 28,29, while LW and DSSR annotate them as canonical. So if I want to get canonical pairs, it seems that I can't use the former two columns, right? what's your advice for the task of retrieving canonical basepairs when the sequence has PSU?


Quote
For users who want to compare DSSR-derived sequences with other resources, they need to pay attention to the lower-case letters and P and take proper actions. By design, the DSSR-derived base sequences from 3D atomic coordinates would be different from those listed in the PDB when pseudouridine (PSU) is involved. I could add a new DSSR option so that users can explicitly set the mapping in cases like 5MU. In my support of DSSR for more than 6 years, however, this ambiguity has not been a concern in practice. Do you think such a feature would be useful to you?

This will definitely help and useful for other users, I believe.

In my workflow, I used your list https://x3dna.org/luxfiles/modified-bases-2013oct18.txt to convert sequence back to standard RNA sequence (AUGCNX) and do sequence-search.  a letter P in the output of DSSR will be treated as proline. My suggestion is to keep the output sequence in line with the IUPAC code in order to reduce ambiguity.
https://www.bioinformatics.org/sms/iupac.html

3
RNA structures (DSSR) / modified nucleotides incorrect.
« on: February 04, 2020, 01:26:15 am »
Hi, Dr. Li,

I've read your post regarding the modified nucleotides issue. https://x3dna.org/highlights/modified-nucleotides-in-the-pdb

However, during my usage, I noticed some modified nucleotides are still incorrect:

PDB: 1ASY_R

output of x3dna-dssr:

UCCGUGAUAGUUPAAuGGuCAGAAUGGGCGCPUGUCgCGUGCCAGAUcGGGGtPCAAUUCCCCGUCGCGGAGCCA

  50  G ( R.G651   0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  51  G ( R.G652   0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  52  G ( R.G653   0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop
  53  t . R.5MU654 0.017  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop
  54  P . R.PSU655 0.011  modified,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor

  55  C ] R.C656   0.019  pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop
  56  A . R.A657   0.010  u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate




the PDB fasta from PDB database:

>1ASY_R
UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA

According to the list in your provided https://x3dna.org/luxfiles/modified-bases-2013oct18.txt

5MU should be U, instead of t, PSU should be u, instead of P

hope this helps.

TC




Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University