Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.0 (DSSR Manual) · Homepage · HIRING!

Author Topic: build dna bulges and extend dna duplex at both terminals via 3dna  (Read 253763 times)

Offline Randy Bin Lin

  • with-posts
  • *
  • Posts: 10
    • View Profile
this is a step-by-step recipe about how to use 3dna to build a dna bulge based on a PDB structure and extend its sequence at both terminals. this is a collection of two posts http://forum.x3dna.org/general-discussions/build-dna-bulge-via-3dna/ and http://forum.x3dna.org/general-discussions/extend-dna-duplex-at-both-terminals/ with much help from Xiang-Jun. Kudos to you!

here's the objective: PDB 1AX6 (http://www.rcsb.org/pdb/files/1AX6.pdb.gz) is a dna bulge of -2 deletion with its sequence as CTCGATGCCATC. I wish to build a similar dna bulge with CT at 5' terminal and AC at 3' terminal as extra. two things worth noting: the first is to preserve the backbone conformation (esp. the bulge region as solved by NMR in the PDB file). the second is essentially how to extend dna duplex (B-DNA in my case). I am sure there are many other ways to do the job (let me know if you know what they are). here's the way I used 3dna to achieve my goal.

1. use find_pair to generate ref_frames.dat for each base pair in 1ax6:
find_pair 1ax6.pdb stdout

2. re-orient 1ax6 based on the reference frame of its first 5' base pair, generate canonical B-DNA of CTC, re-orient it based on the reference frame of its last 3' base:
frame_mol -1 ref_frames.dat 1ax6.pdb 1ax6_ref_frames5.pdb
fiber -b -seq=ctc ctc.pdb
find_pair ctc.pdb ctc.bps
frame_mol -3 ref_frames.dat ctc.pdb ctc_ref_frames5.pdb

3. after step 2, 1ax6_ref_frames5.pdb and ctc_ref_frames5.pdb should superimpose based on the common base pair. cut the coordinates of CT in ctc_ref_frames5.pdb into 1ax6_ref_frames5.pdb and name the new pdb file as 1ax6_extend5.pdb. our sequence has two extra base pairs of CT at 5' terminal with canonical B DNA conformation matching that in 1ax6

4. do the same for the 3' terminal
find_pair 1ax6_extend5.pdb stdout
frame_mol -12 ref_frames.dat 1ax6_extend5.pdb 1ax6_extend5_ref_frames3.pdb
fiber -b -seq=cac cac.pdb
find_pair cac.pdb cac.bps
frame_mol -1 ref_frames.dat cac.pdb cac_ref_frames3.pdb

5. the newly extended pdb at both 5' and 3' terminal is 1ax6_extend53.pdb

6. generate bp_step.par by treating the whole structure as a continuous single helix, this way the bulge of 2 bases is preserved.
find_pair -s 1ax6_extend53.pdb stdout | analyze stdin

7. rebuild dna structure with extended terminals and dna bulge of -2 deletion:
x3dna_utils cp_std BDNA
rebuild -atomic bp_step.par bulge-2-full-3dna.pdb

the dna bulge I meant to build has slightly different sequence from 1ax6. just use mutate_bases in 3dna package to do the job. it's omitted here. but should be easy to do. do that before the first step.

hope it helps! feel free to contact me at randybinlin@gmail.com if you have any questions. or post to the forum, Xiang-Jun knows better and he should be able to answer them fairly quickly.

Randy Bin Lin
« Last Edit: June 06, 2012, 09:40:52 am by mumuwenwu »

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1736
    • View Profile
    • 3DNA homepage
Re: build dna bulges and extend dna duplex at both terminals via 3dna
« Reply #1 on: June 06, 2012, 08:59:42 am »
Thanks for posting this recipe! Note that the whole procedure can be easily automated into a script to ensure reproducibility.

3DNA has more to offer than commonly assumed, especially for applications related to DNA-protein complexes and RNA structures. Your case serves as yet another example illustrating 3DNA's effectiveness and versatility in real world applications.

Thanks again for your effort in putting together the recipe!

Xiang-Jun
« Last Edit: June 11, 2012, 12:19:37 pm by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline cllawson

  • non-commercial
  • with-posts
  • *
  • Posts: 25
    • View Profile
Re: build dna bulges and extend dna duplex at both terminals via 3dna
« Reply #2 on: May 01, 2013, 03:43:37 pm »
Hi,  just wanted to share an alternate way to extend a reference DNA duplex with straight DNA at both termini. I just did this for the purposes of making a picture, so I didn't really care about matching up residue numbers, just superimposing DNA ends.

as an example, say strand 1 of the reference duplex has the sequence TCGGGCTAGCTAGATTTG. 

(1) Identify the first few (say 4 or 5) nucleotides at the 5' end of the reference duplex strand 1:  TCGGG

(2) Identify the last few (say 4 or 5) nucleotides at the 3' end of the reference duplex strand 1:  ATTTG

(3) build a straight DNA duplex with extension sequence lacking TCGGG + TCGGG. 
e.g.,  ACTGACTGACTGACTGTCGGG

You can use 3DNA or, even easier, use the w3dna server (http://w3dna.rutgers.edu/index.php/rebuild). 

(4) build a second straight DNA duplex with  sequence ATTTG + extension sequence lacking ATTTG.
e.g., ATTTGACTGACTGACTGACTGACTG

(5) load the three duplexes into UCSF Chimera, and use the structure comparison MatchMaker Tool to superpose the ends of the extension DNAs on the original structure (it works by aligning the sequences).   First select strands 1 and 2 of the duplex you want to extend as the reference, then select the 1st extension duplex strands for matching.  Then repeat with the 2nd extension duplex.  Make sure to pick the nucleic acid scoring option.

(6) if needed, trim off some or all of the overlapping bases for the picture.

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University