Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Author Topic: DSSR: Software for Defining the (Secondary) Structures of RNA  (Read 125985 times)

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Note added on March 28, 2015: Please visit "DSSR: Dissecting the Spatial Structure of RNA"


As the number of experimentally solved RNA-containing structures grows, it is becoming increasingly important to characterize the geometric features of the molecules consistently and efficiently. Existing RNA bioinformatics tools are fragmented, and suffer in either scope or usability. DSSR, a new 3DNA program for Defining the Secondary Structures of RNA from three-dimensional (3D) coordinates, is designed to streamline the analyses of 3D RNA structures. It consolidates, refines, and significantly extends the functionality of 3DNA for RNA structural analysis.

Starting from an RNA structure in PDB or PDBx/mmCIF format, DSSR employs a set of simple geometric criteria to identify all existent base pairs (bp): either canonical Watson-Crick and wobble pairs or non-canonical pairs with at least one hydrogen bond. The latter pairs may include normal or modified bases, regardless of tautomeric or protonation state. DSSR uses the six standard rigid-body bp parameters (shear, stretch, stagger, propeller, buckle, and opening) to rigorously quantify the spatial disposition of any two interacting bases. Where applicable, the program also denotes a bp by common names, the Saenger classification scheme of 28 H-bonding types, and the Leontis-Westhof nomenclature of 12 basic geometric classes.

DSSR detects multiplets (triplets or higher-order base associations) by searching horizontally in the plane of the associated bp for further H-bonding interactions. The program determines double-helical regions by exploring vertically in the neighborhood of selected bps for base-stacking interactions, regardless of backbone connection (e.g., coaxial stacking of helices). DSSR then identifies hairpin loops, bulges, internal loops, and multi-branch loops (junctions), and recognizes the existence of pseudo-knots. The program outputs RNA secondary structure in dot-bracket notation (dbn) and connect table (.ct) format that can be fed directly into visualization tools (such as VARNA).

DSSR classifies dinucleotide steps into the most common A-, B-, or Z-form double helices, calculates commonly used backbone torsion angles, and assigns the consensus RNA backbone suite names. The program also identifies A-minor interactions, ribose zippers, G quartets, kissing loops, U-turns, and kink-turns. Furthermore, it reports non-pairing interactions (H-bonding or base-stacking) between two nucleotides, and contacts involving phosphate groups.

Currently at version 1.2, DSSR is in a stable and mature state. A simple web interface and a comprehensive user manual are available. Supported by Dr. Robert Hanson, DSSR has recently been integrated into Jmol, a popular molecular graphics program. DSSR-related news and information can be found on the 3DNA homepage. Questions and suggestions are always welcome on the 3DNA forum.

Give DSSR a try, compare it with similar tools in terms of usability, functionality and support, and see the differences!

Current version: DSSR v1.2.5-2015mar19. Release history (in reverse chronological order)



List of users who has helped improve DSSR by reporting bugs, making comments/suggestions etc:

jyvdf3asdg2; kailsen; MarcParisien; jctoledo; Auffinger; febos; acolasanti; hansonr; cllawson; cllawson; Sylverlin

-- Xiang-Jun


Note: please start a new topic with a more specific title; do not post directly below this announcement.


Here are some sample runs (see x3dna-dssr -h for more info),
Code: [Select]
x3dna-dssr -i=1msy.pdb -o=1msy.out  # 27 nts
x3dna-dssr --input=1msy.pdb --output=1msy.out # as as above
x3dna-dssr -i=1ehz.pdb -o=1ehz.out  # tRNA, 76 nts
x3dna-dssr -i=1jj2.pdb -o=1jj2.out  # rRNA, 2876 nts

Example #1: GUAA tetraloop mutant of Sarcin/Ricin domain from E. Coli 23 S rRNA (1msy)

Code: [Select]
Run: x3dna-dssr -i=1msy.pdb -o=1msy.out --non-pair --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1msy.pdb --u-turn --non-pair -o=1msy.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1msy.pdb
    no. of DNA/RNA chains: 1 [A=27]
    no. of nucleotides:    27
    no. of atoms:          685
    no. of waters:         109
    no. of metals:         0

****************************************************************************
List of 13 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.U2647        A.G2673        U-G Wobble      28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble      28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC          19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC          20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC          19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC          19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --          n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --          n/a       tHH  tM+M
   9 A.G2655        A.U2656        G+U Platform    n/a       cSH  cm+M
  10 A.U2656        A.A2665        U-A rHoogsteen  24-XXIV   tWH  tW-M
  11 A.A2657        A.G2664        A-G Sheared     11-XI     tHS  tM-m
  12 A.C2658        A.G2663        C-G WC          19-XIX    cWW  cW-W
  13 A.G2659        A.A2662        G-A Sheared     11-XI     tSH  tm-M

****************************************************************************
List of 1 multiplet
   1 nts=3 GUA A.G2655,A.U2656,A.A2665

****************************************************************************
List of 1 helix
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[1] bps=12
      strand-1 5'-UGCUCCUAUACG-3'
       bp-type    ||||||....|.
      strand-2 3'-GUGAGGCCAGGA-5'
      helix-form  ..AAA..x...
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --           n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --           n/a       tHH  tM+M
   9 A.U2656        A.A2665        U-A rHoogsteen   24-XXIV   tWH  tW-M
  10 A.A2657        A.G2664        A-G Sheared      11-XI     tHS  tM-m
  11 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W
  12 A.G2659        A.A2662        G-A Sheared      11-XI     tSH  tm-M

****************************************************************************
List of 1 stem
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=6
      strand-1 5'-UGCUCC-3'
       bp-type    ||||||
      strand-2 3'-GUGAGG-5'
      helix-form  ..AAA
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 30 non-pairing interactions
   1 A.U2647        A.G2648        stacking: 1.0(0.5)--pm(>>,forward)
   2 A.G2648        A.C2649        stacking: 7.3(4.6)--pm(>>,forward)
   3 A.G2648        A.G2673        stacking: 2.0(0.2)--mm(<>,outward)
   4 A.C2649        A.U2650        stacking: 2.8(1.1)--pm(>>,forward)
   5 A.U2650        A.C2651        stacking: 0.6(0.0)--pm(>>,forward)
   6 A.C2651        A.C2652        stacking: 0.5(0.1)--pm(>>,forward)
   7 A.C2652        A.U2653        stacking: 5.2(2.6)--pm(>>,forward)
   8 A.C2652        A.G2669        stacking: 0.2(0.0)--mm(<>,outward)
   9 A.U2653        A.A2654        stacking: 3.3(2.0)--pp(><,inward) H-bonds[1]: "OP2-O2'(hydroxyl)[2.62]"
  10 A.A2654        A.U2656        stacking: 3.7(1.1)--mm(<>,outward) H-bonds[1]: "O4'*O4'[3.05]"
  11 A.G2655        A.G2664        stacking: 4.4(2.2)--pp(><,inward) H-bonds[1]: "O2'(hydroxyl)-O6(carbonyl)[3.09]"
  12 A.G2655        A.A2665        H-bonds[3]: "N1(imino)-OP2[2.77],N2(amino)-OP2[3.34],N2(amino)-O5'[2.89]"
  13 A.U2656        A.G2664        H-bonds[2]: "OP2-N1(imino)[3.04],OP2-N2(amino)[2.94]"
  14 A.A2657        A.C2658        stacking: 6.7(2.6)--pm(>>,forward)
  15 A.A2657        A.A2665        stacking: 3.7(3.3)--mm(<>,outward)
  16 A.C2658        A.G2659        stacking: 0.4(0.1)--pm(>>,forward)
  17 A.G2659        A.A2661        H-bonds[1]: "O2'(hydroxyl)-N7[2.60]"
  18 A.G2659        A.G2663        stacking: 3.9(1.2)--mm(<>,outward)
  19 A.U2660        A.A2661        stacking: 7.5(4.2)--pm(>>,forward)
  20 A.A2661        A.A2662        stacking: 6.3(4.4)--pm(>>,forward)
  21 A.G2663        A.G2664        stacking: 2.7(0.6)--pm(>>,forward)
  22 A.G2664        A.A2665        H-bonds[1]: "O2'(hydroxyl)-O4'[2.75]"
  23 A.A2665        A.C2666        stacking: 1.6(1.1)--pm(>>,forward)
  24 A.C2666        A.C2667        stacking: 4.3(2.1)--pm(>>,forward)
  25 A.C2667        A.G2668        stacking: 3.1(1.0)--pm(>>,forward)
  26 A.G2668        A.G2669        stacking: 4.3(3.0)--pm(>>,forward)
  27 A.G2669        A.A2670        stacking: 4.3(2.9)--pm(>>,forward)
  28 A.A2670        A.G2671        stacking: 1.5(1.5)--pm(>>,forward)
  29 A.G2671        A.U2672        stacking: 7.4(4.0)--pm(>>,forward)
  30 A.U2672        A.G2673        H-bonds[1]: "O2'(hydroxyl)-O4'[3.37]"

****************************************************************************
List of 4 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=3 UAA A.U2660,A.A2661,A.A2662
   2 nts=4 CUAU A.C2652,A.U2653,A.A2654,A.U2656
   3 nts=4 GGGG A.G2655,A.G2664,A.G2663,A.G2659
   4 nts=6 CAACCG A.C2658,A.A2657,A.A2665,A.C2666,A.C2667,A.G2668

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 1 hairpin loop
   1 hairpin loop: nts=6; [4]; linked by [#-1]
     nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
       nts=4 GUAA A.G2659,A.U2660,A.A2661,A.A2662

****************************************************************************
List of 1 internal loop
   1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#-1]
     nts=13 CUAGUACGGACCG A.C2652,A.U2653,A.A2654,A.G2655,A.U2656,A.A2657,A.C2658,A.G2663,A.G2664,A.A2665,A.C2666,A.C2667,A.G2668
       nts=5 UAGUA A.U2653,A.A2654,A.G2655,A.U2656,A.A2657
       nts=4 GACC A.G2664,A.A2665,A.C2666,A.C2667

****************************************************************************
List of 1 U-turn
   1  A.G2659-A.A2662 H-bonds[2]: "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]" nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1msy nts=27 [whole]
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))
>1msy-A #1 nts=27 [chain] RNA
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-iloops.pdb -- an ensemble of internal loops
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Example #2: The crystal structure of yeast phenylalanine tRNA at 1.93 Å resolution (1ehz)

Code: [Select]
Run: x3dna-dssr -i=1ehz.pdb -o=1ehz.out --po4 --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1ehz.pdb --u-turn --po4 -o=1ehz.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1ehz.pdb
    no. of DNA/RNA chains: 1 [A=76]
    no. of nucleotides:    76
    no. of atoms:          1821
    no. of waters:         160
    no. of metals:         9 [Mg=6,Mn=3]

****************************************************************************
List of 11 types of 14 modified nucleotides
      nt    count  list
   1 1MA-a    1    A.1MA58
   2 2MG-g    1    A.2MG10
   3 5MC-c    2    A.5MC40,A.5MC49
   4 5MU-t    1    A.5MU54
   5 7MG-g    1    A.7MG46
   6 H2U-u    2    A.H2U16,A.H2U17
   7 M2G-g    1    A.M2G26
   8 OMC-c    1    A.OMC32
   9 OMG-g    1    A.OMG34
  10 PSU-P    2    A.PSU39,A.PSU55
  11 YYG-g    1    A.YYG37

****************************************************************************
List of 34 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.G1           A.C72          G-C WC          19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC          19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC          19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC          20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC          20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC          20-XX     cWW  cW-W
   8 A.U8           A.A14          U-A rHoogsteen  24-XXIV   tWH  tW-M
   9 A.U8           A.A21          U+A --          n/a       tSW  tm+W
  10 A.A9           A.A23          A+A --          02-II     tHH  tM+M
  11 A.2MG10        A.C25          g-C WC          19-XIX    cWW  cW-W
  12 A.2MG10        A.G45          g+G --          n/a       cHS  cM+m
  13 A.C11          A.G24          C-G WC          19-XIX    cWW  cW-W
  14 A.U12          A.A23          U-A WC          20-XX     cWW  cW-W
  15 A.C13          A.G22          C-G WC          19-XIX    cWW  cW-W
  16 A.G15          A.C48          G+C rWC         22-XXII   tWW  tW+W
  17 A.H2U16        A.U59          u+U --          n/a       tSW  tm+W
  18 A.G18          A.PSU55        G+P --          n/a       tWS  tW+m
  19 A.G19          A.C56          G-C WC          19-XIX    cWW  cW-W
  20 A.G22          A.7MG46        G-g --          07-VII    tHW  tM-W
  21 A.M2G26        A.A44          g-A Imino       08-VIII   cWW  cW-W
  22 A.C27          A.G43          C-G WC          19-XIX    cWW  cW-W
  23 A.C28          A.G42          C-G WC          19-XIX    cWW  cW-W
  24 A.A29          A.U41          A-U WC          20-XX     cWW  cW-W
  25 A.G30          A.5MC40        G-c WC          19-XIX    cWW  cW-W
  26 A.A31          A.PSU39        A-P --          n/a       cWW  cW-W
  27 A.OMC32        A.A38          c-A --          n/a       c.W  c.-W
  28 A.U33          A.A36          U-A --          n/a       tSH  tm-M
  29 A.5MC49        A.G65          c-G WC          19-XIX    cWW  cW-W
  30 A.U50          A.A64          U-A WC          20-XX     cWW  cW-W
  31 A.G51          A.C63          G-C WC          19-XIX    cWW  cW-W
  32 A.U52          A.A62          U-A WC          20-XX     cWW  cW-W
  33 A.G53          A.C61          G-C WC          19-XIX    cWW  cW-W
  34 A.5MU54        A.1MA58        t-a rHoogsteen  24-XXIV   tWH  tW-M

****************************************************************************
List of 4 multiplets
   1 nts=3 UAA A.U8,A.A14,A.A21
   2 nts=3 AUA A.A9,A.U12,A.A23
   3 nts=3 gCG A.2MG10,A.C25,A.G45
   4 nts=3 CGg A.C13,A.G22,A.7MG46

****************************************************************************
List of 2 helices
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[2] bps=15
      strand-1 5'-GCGGAUUcUGUGtPC-3'
       bp-type    ||||||||||||..|
      strand-2 3'-CGCUUAAGACACaGG-5'
      helix-form  AA....xAAAAxx.
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
   8 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   9 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
  10 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
  11 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
  12 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W
  13 A.5MU54        A.1MA58        t-a rHoogsteen   24-XXIV   tWH  tW-M
  14 A.PSU55        A.G18          P+G --           n/a       tSW  tm+W
  15 A.C56          A.G19          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  helix#2[2] bps=15
      strand-1 5'-AAPcUGGAgCUCAGu-3'
       bp-type    ...||||.||||...
      strand-2 3'-UcAGACCgCGAGUCU-5'
      helix-form  x..AAAAxAA.xxx
   1 A.A36          A.U33          A-U --           n/a       tHS  tM-m
   2 A.A38          A.OMC32        A-c --           n/a       cW.  cW-.
   3 A.PSU39        A.A31          P-A --           n/a       cWW  cW-W
   4 A.5MC40        A.G30          c-G WC           19-XIX    cWW  cW-W
   5 A.U41          A.A29          U-A WC           20-XX     cWW  cW-W
   6 A.G42          A.C28          G-C WC           19-XIX    cWW  cW-W
   7 A.G43          A.C27          G-C WC           19-XIX    cWW  cW-W
   8 A.A44          A.M2G26        A-g Imino        08-VIII   cWW  cW-W
   9 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
  10 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
  11 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
  12 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  13 A.A14          A.U8           A-U rHoogsteen   24-XXIV   tHW  tM-W
  14 A.G15          A.C48          G+C rWC          22-XXII   tWW  tW+W
  15 A.H2U16        A.U59          u+U --           n/a       tSW  tm+W

****************************************************************************
List of 4 stems
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=7
      strand-1 5'-GCGGAUU-3'
       bp-type    |||||||
      strand-2 3'-CGCUUAA-5'
      helix-form  AA....
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
  --------------------------------------------------------------------------
  stem#2[#2] bps=4
      strand-1 5'-gCUC-3'
       bp-type    ||||
      strand-2 3'-CGAG-5'
      helix-form  AA.
   1 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
   2 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
   3 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
   4 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#3[#2] bps=4
      strand-1 5'-CCAG-3'
       bp-type    ||||
      strand-2 3'-GGUc-5'
      helix-form  AAA
   1 A.C27          A.G43          C-G WC           19-XIX    cWW  cW-W
   2 A.C28          A.G42          C-G WC           19-XIX    cWW  cW-W
   3 A.A29          A.U41          A-U WC           20-XX     cWW  cW-W
   4 A.G30          A.5MC40        G-c WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#4[#1] bps=5
      strand-1 5'-cUGUG-3'
       bp-type    |||||
      strand-2 3'-GACAC-5'
      helix-form  AAAA
   1 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   2 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
   3 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
   4 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
   5 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.G19          A.C56          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 2 coaxial stacks
   1 Helix#1 contains 2 stems: [#1,#4]
   2 Helix#2 contains 2 stems: [#3,#2]

****************************************************************************
List of 11 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=2 Uc A.U7,A.5MC49
   2 nts=2 UC A.U8,A.C13
   3 nts=2 GA A.G65,A.A66
   4 nts=3 CgC A.C25,A.M2G26,A.C27
   5 nts=3 gAC A.7MG46,A.A21,A.C48
   6 nts=3 GtP A.G53,A.5MU54,A.PSU55
   7 nts=4 GACC A.G1,A.A73,A.C74,A.C75
   8 nts=4 GAcU A.G30,A.A31,A.OMC32,A.U33
   9 nts=5 GGGaC A.G19,A.G57,A.G18,A.1MA58,A.C61
  10 nts=7 gAAgAPc A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
  11 nts=9 GAGAGAGUC A.G43,A.A44,A.G45,A.A9,A.G22,A.A14,A.G15,A.U59,A.C60
     -----------------------------------------------------------------------
  Nucleotides not involved in stacking interactions
     nts=4 uGUA A.H2U17,A.G20,A.U47,A.A76

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 3 hairpin loops
   1 hairpin loop: nts=10; [8]; linked by [#2]
     nts=10 CAGuuGGGAG A.C13,A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21,A.G22
       nts=8 AGuuGGGA A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21
   2 hairpin loop: nts=11; [9]; linked by [#3]
     nts=11 GAcUgAAgAPc A.G30,A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
       nts=9 AcUgAAgAP A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39
   3 hairpin loop: nts=9; [7]; linked by [#4]
     nts=9 GtPCGaUCC A.G53,A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60,A.C61
       nts=7 tPCGaUC A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60

****************************************************************************
List of 1 junction
   1 4-way junction: nts=16; [2,1,5,0]; linked by [#1,#2,#3,#4]
     nts=16 UUAgCgCGAGgUCcGA A.U7,A.U8,A.A9,A.2MG10,A.C25,A.M2G26,A.C27,A.G43,A.A44,A.G45,A.7MG46,A.U47,A.C48,A.5MC49,A.G65,A.A66
       nts=2 UA A.U8,A.A9
       nts=1 g A.M2G26
       nts=5 AGgUC A.A44,A.G45,A.7MG46,A.U47,A.C48
       nts=0

****************************************************************************
List of 1 non-loop single-stranded segment
   1 nts=4 ACCA A.A73,A.C74,A.C75,A.A76

****************************************************************************
List of 1 kissing loop interaction
   1 isolated-pair #-1 between hairpin loops #1 and #3

****************************************************************************
List of 2 U-turns
   1  A.U33-A.A36 H-bonds[1]: "N3(imino)-OP2[2.80]" nts=6 cUgAAg A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37
   2  A.PSU55-A.1MA58 H-bonds[1]: "N3-OP2[2.77]" nts=6 tPCGaU A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59

****************************************************************************
List of 18 phosphate interactions
   1 A.U7            OP1-hbonds[1]: "MG@A.MG580[2.60]"
   2 A.A9            OP2-hbonds[1]: "N4@A.C13[3.01]"
   3 A.A14           OP2-hbonds[1]: "MG@A.MG580[1.93]"
   4 A.H2U16         OP2-cap: "A.H2U16"
   5 A.G18           OP1-hbonds[1]: "O2'@A.H2U17[2.97]"
   6 A.G19           OP1-hbonds[2]: "N4@A.C60[3.27],MN@A.MN530[2.19]"
   7 A.G20           OP1-hbonds[1]: "MG@A.MG540[2.07]"
   8 A.A21           OP2-hbonds[1]: "MG@A.MG540[2.11]"
   9 A.A23           OP2-hbonds[1]: "N6@A.A9[3.12]"
  10 A.A35           OP2-cap: "A.U33"
  11 A.A36           OP2-hbonds[1]: "N3@A.U33[2.80]"
  12 A.YYG37         OP2-hbonds[1]: "MG@A.MG590[2.53]"
  13 A.C48           OP2-hbonds[1]: "O2'@A.7MG46[3.55]"
  14 A.5MC49         OP1-hbonds[1]: "O2'@A.C48[3.13]" OP2-hbonds[1]: "O2'@A.U7[2.68]"
  15 A.U50           OP1-hbonds[1]: "O2'@A.U47[2.71]"
  16 A.G57           OP2-cap: "A.PSU55"
  17 A.1MA58         OP2-hbonds[1]: "N3@A.PSU55[2.77]"
  18 A.C60           OP1-hbonds[1]: "N4@A.C61[3.12]" OP2-hbonds[1]: "O2'@A.1MA58[2.42]"

****************************************************************************
This structure contains 1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ehz nts=76 [whole]
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
>1ehz-A #1 nts=76 [chain] RNA
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch)
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Note: shown above, the 3-dimensional schematic images (with rectangular base blocks) were created with the 3DNA blocview program to generate .r3d-formatted files that were ray-traced using PyMOL. The 2-dimensional diagrams were produced with VARNA: Visualization Applet for RNA using DSSR-derived base sequence and dot-bracket notation of secondary structure:
Code: [Select]
>1msy-A #1 RNA with 27 nts
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).

>1ehz-A #1 RNA with 76 nts
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGuPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
« Last Edit: May 20, 2016, 02:34:59 pm by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University