Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · Homepage · DSSR · Web-DSSR · DSSR Manual · Reproduce DSSR · DSSR-Jmol · DSSR-PyMOL · Web-SNAP

Messages - xiangjun

Pages: 1 2 [3] 4 5 ... 80
31
DNA-protein interactions (SNAP) / Re: Implement Json
« on: March 10, 2018, 09:44:41 pm »
Yes.

32
RNA structures (DSSR) / Re: discarded nucleotides in json output
« on: March 04, 2018, 10:46:09 am »
Hi,

Thanks for a thoughtful post.

Quote
I am a strong believer in collaboration in methods development trough connectible building blocs, and it is nice to have others with such view in the RNA-modeling field  :)

I cannot agree with you more. I am glad to know of another one of like mind across the Atlantic.

Quote
As I see it, a "&" is inserted in the "bseq" entry for chain breaks. But I can't find any indication of if a nucleotide was discarded or the break was already present in the input pdb, and retrieving it by comparing bseq to the input sequence can be ambiguous.

Yes, the meaning of the symbol "&" in "bseq" with the DBN output is ambiguous. It could be due to: (1) switch of chains for "all_chains" as in a DNA duplex (e.g., 355d), (2) missing atomic coordinates of nucleotides within a DNA/RNA chain, as in some X-ray crystal structures due to local disorder (e.g., 2fk6), (3) abasic sites before DSSR 1.7.3-2017dec26 (which were not considered by default), (4) highly distorted bases, as from some MD simulations, that are out of the default cutoff.

Since you mention you're using v1.7.2-2017nov20, please update to the latest DSSR v1.7.4-2018jan30 that would account for case (3) above.

Quote
I am considering using the "Summary of structural features of xx nucleotides" in the text output, by running dssr w. and wo. the "--json" option. Is there a dssp option I could use to get the info directly from the json output and avoid double work (as I am analysing thousands of pdb files)?

The output of "Summary of structural features of xx nucleotides" matches all the detected nucleotides. This information (plus more) is also available from JSON output, as shown below:
Code: [Select]
x3dna-dssr -i=1ehz.pdb --json | jq .nts
HTH,

Xiang-Jun

33
General discussions (Q&As) / Re: base/nucleotide recognition
« on: February 28, 2018, 06:20:03 pm »
Once again, reproducibility is the key, even for this presumably simple case.

34
General discussions (Q&As) / Re: base/nucleotide recognition
« on: February 28, 2018, 05:08:06 pm »
Let your new PDB file called "AT-new.pdb", here is what I got:

Code: [Select]
# find_pair AT-new.pdb
AT-new.pdb
AT-new.out
    2         # duplex
    1         # number of base-pairs
    1     1    # explicit bp numbering/hetero atoms
    1     2   1 #    1 + ....>A:...1_:[.DA]A-----T[.DT]:...8_:B<....   0.12   0.02  16.77   8.81  -4.01
##### Base-pair criteria used:     4.00     0.00    15.00     2.50    65.00     4.50     7.80 [ O N]
##### 0 non-Watson-Crick base-pairs, and 1 helix (1 isolated bp)
##### Helix #1 (1): 1

# x3dna-dssr -i=AT-new.pdb
List of 1 base pair
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.DA1          B.DT8          A-T WC          20-XX     cWW  cW-W
...

3DNA/DSSR are working as expected.

35
General discussions (Q&As) / Re: base/nucleotide recognition
« on: February 28, 2018, 04:58:16 pm »
Again, show exactly what you did so other can reproduce the problem.

36
General discussions (Q&As) / Re: base/nucleotide recognition
« on: February 28, 2018, 03:06:59 pm »
Thanks for attaching a PDB file that illustrates the problem. The issue is due to erroneous atom names for B.DT8. The C6 atom should be in the six-membered ring, whilst the C5M is the methyl-group attached to C5. In you AT.pdb file, the C6 and C5M atoms are swapped. See the attached image.

Xiang-Jun

37
General discussions (Q&As) / Re: base/nucleotide recognition
« on: February 28, 2018, 02:27:50 pm »
Could you please post a (minimal) example that illustrates the issue unambiguously?

Xiang-Jun

38
DNA-protein interactions (SNAP) / SNAP revision history
« on: February 14, 2018, 11:54:44 pm »
As the list is becoming quite long, for easy reference, I have split up the DSSR release notes from the main post "SNAP: software for characterizing DNA-protein interactions".


Release history (in reverse chronological order):
  • beta-r15-2018feb15 -- added a new section that lists interface stack(s) with 3+ planar moieties. An interface stack is an ordered list of three and more nucleobases and planar moieties of amino acids, assembled together via stacking interactions (nucleobases within to a stem are excluded by default).
  • beta-r14-2018jan05 -- added the --nmr option; classified H-bonds into six categories: phosphate/sugar/base moieties for nucleotides vs backbone/sidechain for amino acids.
  • beta-r13-2017dec31 -- simplified output of H-bonds into mutually exclusive sections (phosphate group, sugar, or base with amino acid); added option --auxfile for producing additional auxiliary files (the default is now only the main output file); miscellaneous bug fixed and code refinements.
  • beta-r12-2017dec26 -- added a summary section of nucleotides with interacting amino acids; revised code to avoid warning messages with GCC v7.
  • beta-r11-2017dec11 -- revised output wording/formatting; added a list of additional files for pairwise H-bonding, base-amino acid pairing/stacking interactions; plus numerous code refinements.
  • beta-r10-2017apr10 -- documented the --type=string where string can be "base" (the default), "backbone", "either", or "both". The "base" argument reports protein interactions with only DNA/RNA base atoms, "backbone" with only DNA/RNA backbone atoms, "either" with base or backbone atoms, and "both" with base plus backbone atoms.
  • beta-r09-2016sept28 -- fixed a bug with the --cleanup option (thanks to jms89).
  • beta-r08-2016jun02 -- added the --tshape (or --t-shape) option to fix issues reported in the Supplemental Table S1 of the Wilson et al. paper "Topology of RNA–protein nucleobase–amino acid π–π interactions and comparison to analogous DNA–protein π–π contacts". Specifically, the authors said:

    "Furthermore, although the recently released beta-r06-2015oct23 version of 3DNA-SNAP (Lu and Olson 2008) is able to distinguish between such errors, and accurately detects stacking interactions between nucleobases and amino acids, it unfortunately is currently unable to identify T-shaped interactions (see, for example, Supplemental Table S1)."

  • beta-r07-2016may21 -- fixed the "Segmentation fault" bug (due to undefined reference frames for certain amino acids with missing side-chain atoms); miscellaneous internal code refinements.
  • beta-r06-2015oct23 -- detected aromatic stacking interactions between bases and amino acids; numerous refinements along with DSSR.
  • beta-r05-2015may03 -- added option --get-hbond to output a list of H-bonds between protein and nucleic acid; numerous internal code refinements.
  • beta-r04-2014sep30 -- removed the (undocumented) --rna option so that RNA-protein complexes are handled the same way as DNA-protein complexes; relaxed default settings so SNAP now runs on pure nucleic acid or protein structures in addition to their complexes; added DSSP output for the protein component in file snap-dssp.txt.
  • beta-r03-2014sep16 -- listed base-AA pseudo-pairs and output an associated PDB ensemble file (snap-pseudoPairs.pdb); significant code speed-up.
  • beta-r02-2014may31 -- detailed listing of H-bonding interactions between a component of nucleotide (base/phosphate/sugar) and an amino acid.
  • beta-r01-2014may05 -- initial release to kick the ball rolling. SNAP identifies base-AA or BP-AA interactions based on a distance cutoff (default to 4.5 angstrom), calculates six parameters to uniquely quantify the spatial relationships, and sets the coordinates in the standard base or BP reference frame for easy visualization and for deriving knowledge-based potentials.

39
General discussions (Q&As) / Re: Elongate RNA pdb structure
« on: January 30, 2018, 11:16:17 am »
Hi Luca,

3DNA does not have a 'straightforward' way to address your questions. However, as shown in the two links in my previous response, some of the 3DNA programs combined could do the trick. I'd help as much as practical.

Alternatively, there are numerous other DNA/RNA modeling programs that may better fit your needs.

Xiang-Jun 

40
FAQs / Re: Why my message has been deleted?
« on: January 30, 2018, 10:26:34 am »
See http://forum.x3dna.org/general-discussions/elongate-rna-pdb-structure/

Yours is a special case in my experience. Note that one can always click the "View the most recent posts on the forum." from the bottom of the Forum.

Xiang-Jun

41
General discussions (Q&As) / Re: Elongate RNA pdb structure
« on: January 30, 2018, 09:48:36 am »
Hi Luca,

Thanks for using 3DNA and for posting your question on the Forum.

I vaguely understand what you want to achieve. Have a look of the following two threads:


It would help if you are specific by using a concrete example.


As a side note, you do not need to post the same question more than once in different sections of the Forum. I’ve removed one of them, and move the remaining one to the more relevant section http://forum.x3dna.org/general-discussions/

Xiang-Jun

42
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« on: January 15, 2018, 01:17:15 pm »
Hi Isaure,

You're welcome. I'm glad that you raised up this issue. As a side note, you could display the secondary structure using VARNA using DSSR-derived dssr-2ndstrs.ct or dssr-2ndstrs.bpseq file (in addition to dssr-2ndstrs.dbn), and you would see the same 'issue'.

In fact, this DBN issue is only one of that many subtle points that are not 'documented'. They are too technical in nature, and too detailed for the majorities of DSSR users. So, for practical considerations, I've decided to address them on a case-by-case base (only) when asked.

Best regards,

Xiang-Jun

43
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« on: January 15, 2018, 12:50:58 pm »
Also, pay attention to DSSR output, as shown below for "4OO8-order1.pdb"

****************************************************************************
Special notes:
   o cross-paired segments in separate chains, be *careful* with .dbn

****************************************************************************
This structure contains *1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.
   o The DSSR-derived dbn may be problematic (see notes above).

44
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« on: January 15, 2018, 12:48:23 pm »
Hi Isaure,

Thanks for your diagnosis of the reported issue.

Quote
I did some more testing, and found that identical PDB files but for the order of the chains get different results.

This is the expected behavior, and what I thought when I first read your post. When deriving the DBN, DSSR assumes the given structure, as a whole, is as if in a continuous chain. Whenever there is a break (between chains or fragments within a chain), an '&' symbol is introduced. When a structure contains more than one chain, they can be ordered differently. DSSR follows the input order strictly, by design. There are tools available to put the chains in 'canonical' order to remove such false 'pseudoknots'.

Best regards,

Xiang-Jun

45
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« on: January 15, 2018, 11:22:37 am »
Hi Isaure,

Thanks for your followup. I've run DSSR on your attached 4OO8-noprot.pdb, and got the following:

Code: [Select]
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-noprot nts=236 [whole]
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&CAGCCAAGCGCACCTAATTTCC
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))&((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&..))))))))))))))))))))
>4OO8-noprot-B #1 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-noprot-C #2 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
>4OO8-noprot-E #3 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-noprot-F #4 nts=22 2.61(1.34) [chain] DNA
CAGCCAAGCGCACCTAATTTCC
..))))))))))))))))))))

So I still did not see the problem you reported. What version of DSSR are you using?

Xiang-Jun

Pages: 1 2 [3] 4 5 ... 80

Created and maintained by Dr. Xiang-Jun Lu [律祥俊], Principal Investigator of the NIH grant R01GM096889
Dr. Lu is currently affiliated with the Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.