Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.5.4 (DSSR Manual) · Homepage

Messages - xiangjun

Pages: 1 ... 41 42 [43] 44 45 ... 65
1051
General discussions (Q&As) / Re: Individual Model images in x3dna_ensemble block_image
« on: October 15, 2013, 05:46:07 pm »
A more logical option would be that you make your script available in the Users' contributions section. Other users then may benefit from your effort.

Xiang-Jun

1052
MD simulations / Re: DNA screwing into protein
« on: October 13, 2013, 03:13:58 pm »
Hi Vito,

Thanks for your kind words about 3DNA, and for sharing your experience on converting MD trajectories file to PDB format.

Quote
I would to study which is the rotation angle value of my whole DNA molecule that is in complex with a protein. basically I'm studying Polymerase, WT and Mutated one, to evaluate if that residue is really involved in. Whit the twist parameter i can't study it. Someone have any suggestion?
I am not quite sure what do you mean by "the rotation angle value" of your whole DNA molecule. Overall, it'd be case-specific as how to quantify changes in relative orientation between DNA molecules in wt vs mutated complexes. The 3DNA algorithm for calculating the base-pair step or helical parameters may be applicable, with a proper definition of coordinate frame.

Xiang-Jun

1053
MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector
« on: October 11, 2013, 02:41:09 pm »
Well, for verification, I have just installed 3DNA v2.1 both Mac OS X and Linux 64-bit on my computer. The content of the bin/ directory is:

Code: [Select]
bin [522] ls
alc2img*        cehs*           find_pair*      mutate_bases*   rebuild*        std_base*       x3dna_utils*
analyze*        comb_str*       find_platform*  o1p_o2p*        regular_dna*    step_hel*
anyhelix*       ex_str*         frame_mol*      pdb2img*        rotate_mol*     x3dna_ensemble*
blocview*       fiber*          get_part*       r3d_atom*       stack2img*      x3dna_setup*

What OS do you have? Please install 3DNA v2.1 in a new directory, and make sure you have the same content as above. If so, then go to $X3DNA/examples/ensemble/md/ and follow README file there.

Xiang-Jun

1054
MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector
« on: October 11, 2013, 09:28:49 am »
Hi Jorge,

You have not downloaded or installed 3DNA v2.1 correctly. The script is now called x3dna_ensemble. You seems not that familiar with the installation procedure. Please ask a local computer expert for help to get started.

Or, post back in details what you have done including the version of 3DNA you download, its location, your OS. Did you run x3dna_setup? What's the output? The point is reproducibility -- we must see exactly where your problems are to help you out.

Xiang-Jun

1055
General discussions (Q&As) / Re: Individual Model images in x3dna_ensemble block_image
« on: October 08, 2013, 08:52:17 pm »
Hi Andrew,

Quote
I am using the x3dna_ensemble program to process NMR and multi model structures.  When I use block_image I get as output a pdb and r3d of the entire ensemble, is it possible to get r3d output for each model using this method?
The resultant .pdb and .r3d files are as expected -- x3dna_ensemble works on an ensemble. To get separate .r3d, you can use the ex_str/blocview command pair for each model explicitly.

Regarding the difference between the following two runs:
Quote
x3dna_ensemble reorient -r "b" -e  in.pdb -o out_reorient_b.pdb
x3dna_ensemble reorient -v -e in.pdb -o out_reorient_e.pdb
See below for help message from x3dna_ensemble reorient -h. Basically, the option "-v (--bestview)" is a short-hand form for "-r 'cb' -k".

Code: [Select]
~ [516] x3dna_ensemble reorient -h
------------------------------------------------------------------------
Reorient models of a MODEL/ENDMDL delineated ensemble of NMR structures
or MD trajectories based on user specified base-pair reference frame or
rotation matrix. Coordinate transformation is perform by 'frame_mol' or
'rotate_mol'. Useful for 'local' structural alignment. The transformed
ensemble can be converted to an image using 'x3dna_ensemble block_image'
and visualized with Jmol or PyMOL.

Usage:
        x3dna_ensemble reorient options
Examples:
        x3dna_ensemble reorient -f 'm -6' -b bpfile.dat -e 2kei.pdb
             # reorient each model using the reference frame of bp #6
             #   with minor groove facing the viewer (-m)
             # options to -f must be quoted, where dash is optional
             #   generate 'model_list.dat', 'ensemble_example_trx.pdb'
        x3dna_ensemble reorient -f '8,9' -b bpfile.dat -e 2kei.pdb
             # reorient each model using the middle reference frame
             #   between base-pairs #8 and #9
        x3dna_ensemble reorient -v -e 2kei.pdb -o extended_view.pdb
             # transform the ensemble to its most extended view and
             #   keep the original relative orientation.
Options:
------------------------------------------------------------------------
    --bpfile, -b <s>:   Name of file containing base-pairing info
   --outfile, -o <s>:   Output file (default: ensemble_example_trx.pdb)
        --single, -s:   Single-stranded DNA/RNA
  --ensemble, -e <s>:   Ensemble delineated with MODEL/ENDMDL pairs
    --models, -m <s>:   File containing an explicit list of model numbers
   --pattern, -p <s>:   Pattern of model files to process (e.g., *.pdb)
      --list, -l <s>:   File containing an explicit list of models
    --rotate, -r <s>:   Options to be transfered to rotate_mol (quoted)
     --frame, -f <s>:   Options to be transfered to frame_mol (quoted)
          --keep, -k:   Keep the original relative orientation
      --bestview, -v:   Set to the most extended view; keep orientation
          --help, -h:   Show this message

HTH,

Xiang-Jun

1056
General discussions (Q&As) / Re: how to run 3dna scripts
« on: October 05, 2013, 10:38:44 pm »
Hi Jorge,

It is surprising that 3DNA v1.5 is still being used. As noted in the download page, this ancient version is no longer supported. You are advised to download v2.1, and follow the instruction "How to install 3DNA on Linux and Windows?" to get started. To verify your installation, and to get a better understanding of what 3DNA is about, please try to reproduce the results reported in the 2008 3DNA Nature Protocols paper.

HTH,

Xiang-Jun

1057
RNA structures (DSSR) / Re: dealing with symmetrics
« on: September 18, 2013, 03:17:13 pm »
Hi Pascal,

I've updated DSSR to beta-r23-on-20130918 on the download page. Please verify and report back if it fixes the problem you experienced.

As a general rule, it helps that users follow up timely on a case-by-case basis rather than post back only when they have a new request or meet another problem.

Xiang-Jun

1058
Feature requests / Re: Notification on format changes
« on: September 18, 2013, 11:28:27 am »
Hi Pascal,

I have split and moved this message from its initial thread on "dealing with symmetrics", since it stands out by itself.

Thanks for the suggestion. Overall, 3DNA v2.x is stable, and I'd be very careful in making any format changes. Form v2.0 and v2.1, the only significant change is the explicit specification of an input file to analyze, which makes the program behave consistently with other 3DNA programs.

As for DSSR, note that it is currently being released in beta. As such, I reserve the freedom to make any changes as I see fit. I normally document significant changes in the release note. It is up to the users to make changes accordingly in their scripts that employ DSSR. Now DSSR possesses features I originally have in mind, and it is becoming stable on its user interface. Moreover, it has laid a solid foundation for future work on RNA structures.

The 3DNA Forum currently has over 1150 registrations, and I do not intend to send a message to the list on every changes I make to DSSR/3DNA. As always, I will be quick in responding to any user questions on the Forum, including those related to format changes.

HTH,

Xiang-Jun


1059
RNA structures (DSSR) / Re: dealing with symmetrics
« on: September 16, 2013, 12:30:30 pm »
Hi Pascal,

Thanks for your following up. As of beta-r19-on-20130819, I have "removed the segid info from nucleotide id-string by default" (see the release note). As you already noticed, segid is not in PDB format v3, nor is it in PDBx/mmCIF. It thus makes sense to me to remove it from the DSSR default output, since it would empty in the majority of cases. However, you can get what to desire by specifying the --segid option explicitly.

HTH,

Xiang-Jun

1060
RNA structures (DSSR) / Re: issues in converting pdb to "dot bracket notation"
« on: September 14, 2013, 11:18:50 pm »
Hi Bhaskar,

Thanks for using DSSR and posting your question(s) on the Forum. The issue you noticed with DSSR-generated "dot bracket notation" for PDB entry 3q1q is as expected in its current implementation. 
>3q1q-B #1 RNA* with 341 nts, in order
GGAGAGGAGCAGGCGGUCGCGGGGGCGCACACCUGCGCUCCCGAGGAAAGUCCGGACUCUGGAGCGGGGUGCCGGGUAACGCCCGGGAGGGGUGACCCUCGGACAGGGCCAUAGAGAAGAAGACCGCCCGGGGGGAAACUUCCGGGCAAGGGUGGAACGGUGGGGUAAGAGCCCACCAGCGUCGGGGCAACCCGGCGGCUUGGCAACCCCCACCUGGAGCAAGGCCAAGCAGGGGGUUGGGUCGCUCCCCUAUUCCCCCGGGUUGGCCGCUUGAGGUGUGCGGUAACGCACACCCCAGAUUGAUGACCGCCACAGAAUCCGGCUUAUGCUCCUCUCCCGUG
((((((((((..((((((.((((.(((((....))))).)))).(...((.((((((((([[[[[.((((((((((.....)))))(((((....)))))((...(((((.............(((((((((((....)))))))))..)).......((((((.......))))))(.(((((((....)))))))..).)))..)))))))))))))...[[[[.....{{{{...<<<..]]]]]>>>....}}}}.(((.]]]]......((((((((....))))))))..........))))))..)....)))))))...))))))))))....
>3q1q-C #2 RNA* with 82 nts, in order
GGCCAGGUAGCUCAGGGAGAGCACUGGAUAUGGGCACCCCCUAAGUCCAGGUGCGGCGGUUCGAUUCCGCCCCUGGCCACCA
(((((((..((((...[.)))).((((((..(((....)))...))))))....(((((..]....))))))))))))))).

Note the *s highlighted above, which signify breaks of nucleobases in the input structure. In DSSR, as in 3DNA, nucleotides are derived from base rings atoms in the PDB or PDBx/mmCIF file. As can be seen below, residue B.U39 in 3q1q has only ATOM records for the backbone (in red), but none for the base. You may want to check for yourself other such cases to account for the inconsistency in number of nts for chains B and C.
ATOM    810  P     C B  38      27.276 -44.145   9.394  1.00 80.00           P  
ATOM    811  OP1   C B  38      26.183 -43.184   9.115  1.00 80.00           O  
ATOM    812  OP2   C B  38      28.673 -43.648   9.404  1.00 80.00           O  
ATOM    813  O5'   C B  38      27.008 -44.858  10.808  1.00 80.00           O  
ATOM    814  C5'   C B  38      25.731 -45.392  11.179  1.00 80.00           C  
ATOM    815  C4'   C B  38      25.723 -45.968  12.591  1.00 80.00           C  
ATOM    816  O4'   C B  38      26.785 -46.947  12.768  1.00 80.00           O  
ATOM    817  C3'   C B  38      25.856 -44.974  13.744  1.00 80.00           C  
ATOM    818  O3'   C B  38      24.919 -45.259  14.795  1.00 80.00           O  
ATOM    819  C2'   C B  38      27.306 -45.149  14.194  1.00 80.00           C  
ATOM    820  O2'   C B  38      27.521 -44.843  15.559  1.00 80.00           O  
ATOM    821  C1'   C B  38      27.517 -46.640  13.943  1.00 80.00           C  
ATOM    822  N1    C B  38      28.967 -47.060  13.807  1.00 80.00           N  
ATOM    823  C2    C B  38      29.617 -47.732  14.873  1.00 80.00           C  
ATOM    824  O2    C B  38      29.007 -48.011  15.918  1.00 80.00           O  
ATOM    825  N3    C B  38      30.930 -48.076  14.726  1.00 80.00           N  
ATOM    826  C4    C B  38      31.592 -47.774  13.597  1.00 80.00           C  
ATOM    827  N4    C B  38      32.876 -48.136  13.507  1.00 80.00           N  
ATOM    828  C5    C B  38      30.960 -47.089  12.509  1.00 80.00           C  
ATOM    829  C6    C B  38      29.668 -46.754  12.659  1.00 80.00           C  
ATOM    830  P     U B  39      24.284 -44.122  15.737  1.00 80.00           P  
ATOM    831  OP1   U B  39      22.814 -44.315  15.717  1.00 80.00           O  
ATOM    832  OP2   U B  39      24.834 -42.793  15.370  1.00 80.00           O  
ATOM    833  O5'   U B  39      24.871 -44.473  17.192  1.00 80.00           O  
ATOM    834  C5'   U B  39      24.438 -45.584  17.981  1.00 80.00           C  
ATOM    835  C4'   U B  39      23.332 -45.180  18.944  1.00 80.00           C  
ATOM    836  C3'   U B  39      23.784 -44.467  20.213  1.00 80.00           C  
ATOM    837  O3'   U B  39      23.540 -43.056  20.125  1.00 80.00           O  
ATOM    838  P     U B  40      24.587 -41.959  20.658  1.00 80.00           P  
ATOM    839  OP1   U B  40      24.649 -42.089  22.135  1.00 80.00           O  
ATOM    840  OP2   U B  40      24.206 -40.655  20.068  1.00 80.00           O  
ATOM    841  O5'   U B  40      25.982 -42.393  19.987  1.00 80.00           O  
ATOM    842  C5'   U B  40      27.208 -42.521  20.704  1.00 80.00           C  
ATOM    843  C4'   U B  40      27.371 -43.944  21.208  1.00 80.00           C  
ATOM    844  O4'   U B  40      27.451 -44.862  20.086  1.00 80.00           O  
ATOM    845  C3'   U B  40      28.594 -44.204  22.075  1.00 80.00           C  
ATOM    846  O3'   U B  40      28.264 -44.010  23.462  1.00 80.00           O  
ATOM    847  C2'   U B  40      28.934 -45.657  21.747  1.00 80.00           C  
ATOM    848  O2'   U B  40      28.276 -46.605  22.568  1.00 80.00           O  
ATOM    849  C1'   U B  40      28.488 -45.807  20.289  1.00 80.00           C  
ATOM    850  N1    U B  40      29.577 -45.683  19.217  1.00 80.00           N  
ATOM    851  C2    U B  40      30.695 -46.550  19.196  1.00 80.00           C  
ATOM    852  O2    U B  40      30.963 -47.437  19.996  1.00 80.00           O  
ATOM    853  N3    U B  40      31.627 -46.340  18.195  1.00 80.00           N  
ATOM    854  C4    U B  40      31.522 -45.386  17.189  1.00 80.00           C  
ATOM    855  O4    U B  40      32.377 -45.290  16.317  1.00 80.00           O  
ATOM    856  C5    U B  40      30.350 -44.542  17.249  1.00 80.00           C  
ATOM    857  C6    U B  40      29.446 -44.715  18.228  1.00 80.00           C 

HTH,

Xiang-Jun

1061
General discussions (Q&As) / Re: Mac OS install problem
« on: September 10, 2013, 03:13:24 pm »
See "Protocol 1 - Install Instructions of 3DNA on a Mac". If you have further questions, please follow up that thread.

Note that the x3dna_setup script uses the 3DNA Linux tarball as an example. You should have downloaded a Mac OS X version.

Xiang-Jun

1062
General discussions (Q&As) / Re: hybrid analysis
« on: September 10, 2013, 10:04:04 am »
That's expected with the analyze program. DSSR provides a classification of each nucleic acid chain (DNA, RNA etc), which may be what you are looking for. Please be specific with a concrete example and tell us what you expect to find.

Xiang-Jun

1063
General discussions (Q&As) / Re: hybrid analysis
« on: September 09, 2013, 10:47:44 am »
3DNA should be able to automatically analyze a hybrid RNA/DNA structure. See section "(D) Automatic identification of double-helical regions in a DNA–RNA junction (Recipe no. 4, Box 2)" of the 2008 3DNA Nature Protocols paper.

Have a try on your structure, and report back any issues you may have.

Xiang-Jun

1064
w3DNA -- web interface to 3DNA / Re: O3'-P distance too long after reconstruction
« on: September 06, 2013, 05:13:48 pm »
Update on 2013-09-06: please see my post titled "Restraint optimization of DNA backbone geometry using PHENIX" for a PHENIX-based method to solve the long O3'-P distance problem.

Xiang-Jun

1065
RNA structures (DSSR) / Re: dssr issue (for modified pdb files)
« on: September 03, 2013, 11:40:59 am »
Hi Pascal,

Thanks for reporting the bug, and supplying an example PDB file. I have traced and fixed the 'rare' error and released an updated version of DSSR. Please have a try of beta-r21-on-20130903 and report back any issues you may still have.

Best regards, and enjoy DSSR!

Xiang-Jun

1066
Bug reports / MOVED: dssr issue (for modified pdb files)
« on: September 03, 2013, 11:36:11 am »
This topic has been moved to RNA structures (DSSR).

http://forum.x3dna.org/index.php?topic=390.0

1067
General discussions (Q&As) / Re: stacking area overlap
« on: September 02, 2013, 10:34:37 am »
Hi Asmita,

For overlap areas along consecutive bases, the following command should do the trick:

Code: [Select]
find_pair -s INPUT.pdb stdout | analyze stdin
# check output file 'INPUT.outs'
Here assuming your PDB input file is INPUT.pdb. Note the -s option, which treats each nt along a strand consecutively. The output file has extension .outs instead of the normal .out for a duplex.

Note also that DSSR has a --non-pair option which characterizes non-pairing interactions, i.e. base-stacking and H-bonding.

HTH,

Xiang-Jun

1068
General discussions (Q&As) / Re: Prediction of Non B-DNA structure
« on: August 17, 2013, 10:54:43 am »
The question sounds too general to me. With 3DNA, you can build an arbitrary DNA structure by providing an input file with sequence and desired parameters. See the 2008 3DNA Nature Protocols paper for details.

Xiang-Jun

1069
General discussions (Q&As) / Re: Prediction of Non B-DNA structure
« on: August 17, 2013, 12:28:34 am »
3DNA/DSSR is an analyzing/modeling toolset. Overall, it does not make 'predictions'. Nevertheless, some of its functionality could prove useful in testing your ideas.

Xiang-Jun

1070
General discussions (Q&As) / Re: areas of the polygons used to calculate base overlap
« on: August 14, 2013, 01:06:13 pm »
Hi Blaine,

Thanks for using 3DNA and posting on the Forum. The following is quoted from the 2003 3DNA NAR paper. Hopefully, it would answer your question.

Quote
The stacking interactions are quantified in 3DNA by the shared overlap area, in Å2, of closely associated base rings, i.e. the nine‐membered ring of a purine R (A or G) and the six‐membered ring of a pyrimidine Y (C, T or U), projected in the mean base pair plane. For example, the overlap areas between base rings on the left strands of the dimer steps shown in Figure 6 are 0.63 Å2 (C3···G2), 0 Å2 (G4···C3) and 1.11 Å2 (A5···G4). To account for the stacking interactions (overlap areas) of exocyclic atoms over base rings, e.g. the overlap of the amino N4 atom of residue C3 with the five‐membered pyrrole ring of base G2 in Figure 6, an extended polygon, which includes exocyclic atoms, is used. For cytosine, the extended polygon is defined by the C1′‐O2‐N3‐N4‐C5‐C6‐C1′ atomic sequence. The overlap areas of the bases on the left strand of Figure 6 increase, respectively, to 2.95, 2.66 and 3.94 Å2 when these and other exocyclic atoms are included in the calculations. The sum of the intra‐ and inter strand stacking overlaps is provided for each dinucleotide step in the 3DNA output.

Best regards,

Xiang-Jun

1071
RNA structures (DSSR) / Re: A/B/Z forms
« on: August 03, 2013, 09:41:49 pm »
Hi Pascal,

Thanks for your feedback to the new functionality of DSSR. To clarify, please note the following two points:
  • The Richardson et al. sugar-phosphate backbone suite name classification deals with a single-stranded dinucleotide (e.g., ApG),  and the 53 conformers have been derived primarily from RNA, but not DNA. Try the classic B-DNA Dickerson dodecamer (CGCGAATTCGCG, 355d) as an example, you'll see many outliers ('!!'). I implemented the suite classification in DSSR mostly for a better understanding of this important community consensus on RNA backbone. You may well want to read the original Richardson et al. (2008) paper and use the official Suitename program.
  • The DSSR A-, B-, Z-form classification method works on a double-stranded dinucleotide step (e.g., ApG/CpT, not a base pair). It is different from the algorithm implemented in 3DNA, and is still experimental.
Thus, I cannot think of a consistent and meaningful way to implement your two suggestions in DSSR. If you find the current DSSR A-, B- and Z-form classification useful in your project, you are welcome to employ the info as you see fit.

Xiang-Jun

1072
General discussions (Q&As) / Re: old Curves?
« on: July 26, 2013, 08:16:59 pm »
Hi Ara,

Thanks for posting on the 3DNA Forum; questions about Curve/Curves+ are certainly not out of topic here.

To get a copy of the "old Curves", did you contact the authors, especially Dr. Richard Lavery? Alternatively, you may check with Dr. Remo Rohs who (as I am aware of) is still using the 'old Curves' (see a recent paper from his lab, titled "DNAshape: a method for the high-throughput prediction of DNA structural features on a genomic scale").

Xiang-Jun

1073
General discussions (Q&As) / Re: DNA origami
« on: June 20, 2013, 10:41:49 am »
One example is by Bai et al. (2012): "Cryo-EM structure of a 3D DNA-origami object", where the authors wrote:

Quote
Model Building. An initial atomic model with the designed topology of parallel dsDNA helices in a rectangular lattice and with the known nucleotide sequence was calculated using custom software that relied on 3DNA (23) to calculate canonical B-DNA for all designed helical fragments.

3DNA does not make predictions -- it is simply a toolbox with facilities for manipulations of 3-dimensional nucleic acid structures. It can be applied 'mechanically' in a particularly situation as users see fit. There may be dedicated tools for DNA origami predictions, but 3DNA is not (yet) one of them.

HTH,

Xiang-Jun

1074
General discussions (Q&As) / Re: DNA origami
« on: June 19, 2013, 01:20:08 pm »
Thanks for posting on the 3DNA Forum. I am aware of the beautiful DNA origami. Unfortunately, 3DNA is not directly applicable for predicting the final origami shape given a ssDNA sequence. However, I vaguely remember some publications where 3DNA was used in certain steps of the model building process.

Xiang-Jun

1075
RNA structures (DSSR) / Re: dealing with symmetrics
« on: June 18, 2013, 06:20:57 pm »
Hi Pascal,

I've updated DSSR to beta-r13-on-20130618 which took into consideration of segid, among other refinements. Using your sample PDB file as an example, the output is as below:

Code: [Select]
Run: x3dna-dssr -i=100d.py.pdb -o=100d.py.out --long-idstr  --note=no

****************************************************************************
    DSSR: Software for Defining the (Secondary) Structures of RNA
      by Xiang-Jun Lu (xiangjun@x3dna.org), beta-r13-on-20130618

   The program is currently under active development. As always, we
   greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (http://forum.x3dna.org/). I strive to
   respond promptly to any questions posted there.

****************************************************************************
Date and time: Tue Jun 18 22:23:15 2013
File name: 100d.py.pdb
    no. of DNA/RNA chains: 2 [A=24, B=25]
    no. of nucleotides:    49
    no. of waters:         92
    no. of metals:         0

****************************************************************************
List of 35 base pair(s)
   1 ..A.C.1.         ..B.G.20.        C-G WC           19-XIX    cWW cW-W
       -161.7(anti) C3'-endo lambda=54.3; -147.2(anti) C3'-endo lambda=54.3
       d(C1'-C1')=10.74 d(N1-N9)=9.02 d(C6-C8)=9.92 tor(N1-C1'-C1'-N9)=-17.1
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.77]; N3-N1(imino)[2.93]; N4(amino)-O6(carbonyl)[2.93]"
       bp_pars: [0.07    -0.09   0.04    3.92    -8.78   -0.90]
   2 ..A.DC.2.        ..B.DG.19.       C-G WC           19-XIX    cWW cW-W
       -163.8(anti) C3'-endo lambda=52.9; -173.5(anti) C3'-endo lambda=52.9
       d(C1'-C1')=10.70 d(N1-N9)=8.93 d(C6-C8)=9.82 tor(N1-C1'-C1'-N9)=-13.1
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.72]; N3-N1(imino)[2.87]; N4(amino)-O6(carbonyl)[2.83]"
       bp_pars: [-0.02   -0.17   -0.06   4.83    -9.56   -1.89]
   3 ..A.DG.3.        ..B.DC.18.       G-C WC           19-XIX    cWW cW-W
       -156.0(anti) C3'-endo lambda=55.2; -163.4(anti) C3'-endo lambda=54.8
       d(C1'-C1')=10.58 d(N1-N9)=8.90 d(C6-C8)=9.85 tor(N1-C1'-C1'-N9)=-17.6
       H-bonds[3]: "O6(carbonyl)-N4(amino)[3.08]; N1(imino)-N3[2.91]; N2(amino)-O2(carbonyl)[2.68]"
       bp_pars: [-0.35   -0.16   -0.04   2.66    -10.59  1.38]
   4 ..A.DG.3.        .B00A.A.G.10.    G-G              00-n/a    c.S c.-m
       -156.0(anti) C3'-endo lambda=108.7; -153.1(anti) C3'-endo lambda=149.2
       d(C1'-C1')=5.60 d(N1-N9)=7.39 d(C6-C8)=9.83 tor(N1-C1'-C1'-N9)=-26.9
       H-bonds[2]: "N2(amino)-N3[3.23]; N3-O2'(hydroxyl)[2.69]"
       bp_pars: [-2.57   7.21    -2.45   -44.65  21.25   152.60]
   5 ..A.DG.4.        ..B.DC.17.       G-C WC           19-XIX    cWW cW-W
       -143.6(anti) C3'-endo lambda=53.5; -161.7(anti) C3'-endo lambda=53.8
       d(C1'-C1')=10.66 d(N1-N9)=8.91 d(C6-C8)=9.84 tor(N1-C1'-C1'-N9)=-23.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.88]; N1(imino)-N3[2.80]; N2(amino)-O2(carbonyl)[2.67]"
       bp_pars: [-0.24   -0.20   0.09    -2.07   -10.90  0.44]
   6 ..A.DG.4.        .B00A.A.G.10.    G-G              00-n/a    cSS tm-m
       -143.6(anti) C3'-endo lambda=110.1; -153.1(anti) C3'-endo lambda=103.0
       d(C1'-C1')=4.65 d(N1-N9)=5.97 d(C6-C8)=7.86 tor(N1-C1'-C1'-N9)=109.9
       H-bonds[1]: "N3-N2(amino)[3.15]"
       bp_pars: [-2.15   -7.43   1.59    46.36   -29.54  -165.95]
   7 ..A.DG.4.        .B00A.B.C.11.    G+C              00-n/a    tS. tm+.
       -143.6(anti) C3'-endo lambda=82.8; -159.1(anti) C3'-endo lambda=73.0
       d(C1'-C1')=9.02 d(N1-N9)=8.85 d(C6-C8)=11.20 tor(N1-C1'-C1'-N9)=-147.3
       H-bonds[1]: "N2(amino)-O2(carbonyl)[3.36]"
       bp_pars: [-2.30   -7.57   2.20    41.36   -27.41  -161.33]
   8 ..A.DC.5.        ..B.DG.16.       C-G WC           19-XIX    cWW cW-W
       -163.6(anti) C3'-endo lambda=57.0; -164.3(anti) C3'-endo lambda=55.2
       d(C1'-C1')=10.41 d(N1-N9)=8.78 d(C6-C8)=9.71 tor(N1-C1'-C1'-N9)=-15.6
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.73]; N3-N1(imino)[2.81]; N4(amino)-O6(carbonyl)[2.84]"
       bp_pars: [0.38    -0.31   0.40    3.58    -12.55  -0.99]
   9 ..A.DG.6.        ..B.DC.15.       G-C WC           19-XIX    cWW cW-W
       -158.8(anti) C3'-endo lambda=54.6; -152.0(anti) C2'-exo lambda=55.3
       d(C1'-C1')=10.85 d(N1-N9)=9.16 d(C6-C8)=10.10 tor(N1-C1'-C1'-N9)=-24.1
       H-bonds[3]: "O6(carbonyl)-N4(amino)[3.02]; N1(imino)-N3[3.07]; N2(amino)-O2(carbonyl)[2.91]"
       bp_pars: [-0.16   0.05    0.03    -1.64   -16.84  0.00]
  10 ..A.DC.7.        ..B.DG.14.       C-G WC           19-XIX    cWW cW-W
       -153.4(anti) C3'-endo lambda=56.2; -162.2(anti) C3'-endo lambda=54.8
       d(C1'-C1')=10.52 d(N1-N9)=8.85 d(C6-C8)=9.78 tor(N1-C1'-C1'-N9)=-15.6
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.67]; N3-N1(imino)[2.81]; N4(amino)-O6(carbonyl)[2.85]"
       bp_pars: [0.42    -0.26   -0.10   2.69    -7.28   0.66]
  11 ..A.DC.7.        .D000.B.G.20.    C+G              00-n/a    tSW tm+W
       -153.4(anti) C3'-endo lambda=86.2; -147.2(anti) C3'-endo lambda=51.8
       d(C1'-C1')=8.36 d(N1-N9)=7.77 d(C6-C8)=9.62 tor(N1-C1'-C1'-N9)=145.0
       H-bonds[1]: "O2(carbonyl)-N2(amino)[2.92]"
       bp_pars: [-2.42   -7.23   2.20    -58.75  -25.30  -144.63]
  12 ..A.DC.8.        ..B.DG.13.       C-G WC           19-XIX    cWW cW-W
       -170.0(anti) C3'-endo lambda=57.0; -178.7(anti) C2'-exo lambda=52.7
       d(C1'-C1')=10.66 d(N1-N9)=8.96 d(C6-C8)=9.90 tor(N1-C1'-C1'-N9)=-5.4
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.74]; N3-N1(imino)[2.96]; N4(amino)-O6(carbonyl)[3.06]"
       bp_pars: [0.53    -0.13   -0.14   2.56    -6.75   2.31]
  13 ..A.DG.9.        ..B.DC.12.       G-C WC           19-XIX    cWW cW-W
       -172.0(anti) C3'-endo lambda=50.1; -151.8(anti) C3'-endo lambda=55.4
       d(C1'-C1')=10.78 d(N1-N9)=8.97 d(C6-C8)=9.86 tor(N1-C1'-C1'-N9)=-7.2
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.88]; N1(imino)-N3[2.85]; N2(amino)-O2(carbonyl)[2.69]"
       bp_pars: [-0.09   -0.14   -0.09   -3.82   -2.75   0.30]
  14 ..A.G.10.        ..B.C.11.        G-C WC           19-XIX    cWW cW-W
       -153.1(anti) C3'-endo lambda=51.2; -159.1(anti) C3'-endo lambda=53.6
       d(C1'-C1')=10.60 d(N1-N9)=8.79 d(C6-C8)=9.60 tor(N1-C1'-C1'-N9)=-14.5
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.63]; N1(imino)-N3[2.67]; N2(amino)-O2(carbonyl)[2.64]"
       bp_pars: [-0.26   -0.41   -0.03   -0.15   -5.96   -3.32]
  15 ..A.G.10.        .B000.A.DG.3.    G-G              00-n/a    cS. cm-.
       -153.1(anti) C3'-endo lambda=149.2; -156.0(anti) C3'-endo lambda=108.7
       d(C1'-C1')=5.60 d(N1-N9)=7.39 d(C6-C8)=9.83 tor(N1-C1'-C1'-N9)=-26.9
       H-bonds[2]: "O2'(hydroxyl)-N3[2.69]; N3-N2(amino)[3.23]"
       bp_pars: [2.57    7.21    -2.45   44.65   21.25   152.60]
  16 ..A.G.10.        .B000.A.DG.4.    G-G              00-n/a    cSS tm-m
       -153.1(anti) C3'-endo lambda=103.0; -143.6(anti) C3'-endo lambda=110.1
       d(C1'-C1')=4.65 d(N1-N9)=5.97 d(C6-C8)=7.86 tor(N1-C1'-C1'-N9)=109.9
       H-bonds[1]: "N2(amino)-N3[3.15]"
       bp_pars: [2.15    -7.43   1.59    -46.36  -29.54  -165.95]
  17 ..A.G.10.        .B000.B.DC.18.   G+C              00-n/a    tWS tW+m
       -153.1(anti) C3'-endo lambda=58.2; -163.4(anti) C3'-endo lambda=85.5
       d(C1'-C1')=8.53 d(N1-N9)=8.08 d(C6-C8)=10.10 tor(N1-C1'-C1'-N9)=150.3
       H-bonds[1]: "N2(amino)-O2(carbonyl)[3.02]"
       bp_pars: [2.68    7.77    -1.82   55.69   20.84   153.44]
  18 ..B.C.11.        .B000.A.DG.4.    C+G              00-n/a    t.S t.+m
       -159.1(anti) C3'-endo lambda=73.0; -143.6(anti) C3'-endo lambda=82.8
       d(C1'-C1')=9.02 d(N1-N9)=8.85 d(C6-C8)=11.20 tor(N1-C1'-C1'-N9)=-147.3
       H-bonds[1]: "O2(carbonyl)-N2(amino)[3.36]"
       bp_pars: [2.30    7.57    -2.20   -41.36  27.41   161.33]
  19 ..B.DG.14.       .D000.B.G.20.    G-G              00-n/a    cWS cW-m
       -162.2(anti) C3'-endo lambda=106.8; -147.2(anti) C3'-endo lambda=144.4
       d(C1'-C1')=5.59 d(N1-N9)=7.23 d(C6-C8)=9.62 tor(N1-C1'-C1'-N9)=-16.3
       H-bonds[2]: "N2(amino)-N3[2.91]; N3-O2'(hydroxyl)[2.76]"
       bp_pars: [-2.32   6.66    -2.35   -52.39  21.07   146.45]
  20 ..B.DC.15.       .D000.B.G.20.    C-G              00-n/a    cSS tm-m
       -152.0(anti) C2'-exo lambda=109.8; -147.2(anti) C3'-endo lambda=109.9
       d(C1'-C1')=5.30 d(N1-N9)=6.63 d(C6-C8)=8.75 tor(N1-C1'-C1'-N9)=95.6
       H-bonds[1]: "O2(carbonyl)-N2(amino)[3.10]"
       bp_pars: [1.68    7.67    0.61    -44.53  37.97   179.58]
  21 ..B.DC.18.       .B00A.A.G.10.    C+G              00-n/a    tSW tm+W
       -163.4(anti) C3'-endo lambda=85.5; -153.1(anti) C3'-endo lambda=58.2
       d(C1'-C1')=8.53 d(N1-N9)=8.08 d(C6-C8)=10.10 tor(N1-C1'-C1'-N9)=150.3
       H-bonds[1]: "O2(carbonyl)-N2(amino)[3.02]"
       bp_pars: [-2.68   -7.77   1.82    -55.69  -20.84  -153.44]
  22 ..B.G.20.        .D0A0.A.DC.7.    G+C              00-n/a    tWS tW+m
       -147.2(anti) C3'-endo lambda=51.8; -153.4(anti) C3'-endo lambda=86.2
       d(C1'-C1')=8.36 d(N1-N9)=7.77 d(C6-C8)=9.62 tor(N1-C1'-C1'-N9)=145.0
       H-bonds[1]: "N2(amino)-O2(carbonyl)[2.92]"
       bp_pars: [2.42    7.23    -2.20   58.75   25.30   144.63]
  23 ..B.G.20.        .D0A0.B.DG.14.   G-G              00-n/a    cSW cm-W
       -147.2(anti) C3'-endo lambda=144.4; -162.2(anti) C3'-endo lambda=106.8
       d(C1'-C1')=5.59 d(N1-N9)=7.23 d(C6-C8)=9.62 tor(N1-C1'-C1'-N9)=-16.3
       H-bonds[2]: "O2'(hydroxyl)-N3[2.76]; N3-N2(amino)[2.91]"
       bp_pars: [2.32    6.66    -2.35   52.39   21.07   146.45]
  24 ..B.G.20.        .D0A0.B.DC.15.   G-C              00-n/a    cSS tm-m
       -147.2(anti) C3'-endo lambda=109.9; -152.0(anti) C2'-exo lambda=109.8
       d(C1'-C1')=5.30 d(N1-N9)=6.63 d(C6-C8)=8.75 tor(N1-C1'-C1'-N9)=95.6
       H-bonds[1]: "N2(amino)-O2(carbonyl)[3.10]"
       bp_pars: [-1.68   7.67    0.61    44.53   37.97   179.58]
  25 .B000.A.DG.3.    .B000.B.DC.18.   G-C WC           19-XIX    cWW cW-W
       -156.0(anti) C3'-endo lambda=55.2; -163.4(anti) C3'-endo lambda=54.8
       d(C1'-C1')=10.58 d(N1-N9)=8.90 d(C6-C8)=9.85 tor(N1-C1'-C1'-N9)=-17.6
       H-bonds[3]: "O6(carbonyl)-N4(amino)[3.08]; N1(imino)-N3[2.91]; N2(amino)-O2(carbonyl)[2.68]"
       bp_pars: [-0.35   -0.16   -0.04   2.66    -10.59  1.38]
  26 .B000.A.DG.4.    .B000.B.DC.17.   G-C WC           19-XIX    cWW cW-W
       -143.6(anti) C3'-endo lambda=53.5; -161.7(anti) C3'-endo lambda=53.8
       d(C1'-C1')=10.66 d(N1-N9)=8.91 d(C6-C8)=9.84 tor(N1-C1'-C1'-N9)=-23.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.88]; N1(imino)-N3[2.80]; N2(amino)-O2(carbonyl)[2.67]"
       bp_pars: [-0.24   -0.20   0.09    -2.07   -10.90  0.44]
  27 .B000.B.G.20.    .CA00.B.DG.14.   G-G              00-n/a    cSW cm-W
       -147.2(anti) C3'-endo lambda=144.4; -162.2(anti) C3'-endo lambda=106.8
       d(C1'-C1')=5.59 d(N1-N9)=7.23 d(C6-C8)=9.62 tor(N1-C1'-C1'-N9)=-16.3
       H-bonds[2]: "O2'(hydroxyl)-N3[2.76]; N3-N2(amino)[2.91]"
       bp_pars: [2.32    6.66    -2.35   52.39   21.07   146.45]
  28 .B000.B.G.20.    .CA00.B.DC.15.   G-C              00-n/a    cSS tm-m
       -147.2(anti) C3'-endo lambda=109.9; -152.0(anti) C2'-exo lambda=109.8
       d(C1'-C1')=5.30 d(N1-N9)=6.63 d(C6-C8)=8.75 tor(N1-C1'-C1'-N9)=95.6
       H-bonds[1]: "N2(amino)-O2(carbonyl)[3.10]"
       bp_pars: [-1.68   7.67    0.61    44.53   37.97   179.58]
  29 .C000.A.G.10.    .D000.A.DG.3.    G-G              00-n/a    cS. cm-.
       -153.1(anti) C3'-endo lambda=149.2; -156.0(anti) C3'-endo lambda=108.7
       d(C1'-C1')=5.60 d(N1-N9)=7.39 d(C6-C8)=9.83 tor(N1-C1'-C1'-N9)=-26.9
       H-bonds[2]: "O2'(hydroxyl)-N3[2.69]; N3-N2(amino)[3.23]"
       bp_pars: [2.57    7.21    -2.45   44.65   21.25   152.60]
  30 .D000.A.C.1.     .D000.B.G.20.    C-G WC           19-XIX    cWW cW-W
       -161.7(anti) C3'-endo lambda=54.3; -147.2(anti) C3'-endo lambda=54.3
       d(C1'-C1')=10.74 d(N1-N9)=9.02 d(C6-C8)=9.92 tor(N1-C1'-C1'-N9)=-17.1
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.77]; N3-N1(imino)[2.93]; N4(amino)-O6(carbonyl)[2.93]"
       bp_pars: [0.07    -0.09   0.04    3.92    -8.78   -0.90]
  31 .B00A.A.DG.9.    .B00A.B.DC.12.   G-C WC           19-XIX    cWW cW-W
       -172.0(anti) C3'-endo lambda=50.1; -151.8(anti) C3'-endo lambda=55.4
       d(C1'-C1')=10.78 d(N1-N9)=8.97 d(C6-C8)=9.86 tor(N1-C1'-C1'-N9)=-7.2
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.88]; N1(imino)-N3[2.85]; N2(amino)-O2(carbonyl)[2.69]"
       bp_pars: [-0.09   -0.14   -0.09   -3.82   -2.75   0.30]
  32 .B00A.A.G.10.    .B00A.B.C.11.    G-C WC           19-XIX    cWW cW-W
       -153.1(anti) C3'-endo lambda=51.2; -159.1(anti) C3'-endo lambda=53.6
       d(C1'-C1')=10.60 d(N1-N9)=8.79 d(C6-C8)=9.60 tor(N1-C1'-C1'-N9)=-14.5
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.63]; N1(imino)-N3[2.67]; N2(amino)-O2(carbonyl)[2.64]"
       bp_pars: [-0.26   -0.41   -0.03   -0.15   -5.96   -3.32]
  33 .D0A0.A.DG.6.    .D0A0.B.DC.15.   G-C WC           19-XIX    cWW cW-W
       -158.8(anti) C3'-endo lambda=54.6; -152.0(anti) C2'-exo lambda=55.3
       d(C1'-C1')=10.85 d(N1-N9)=9.16 d(C6-C8)=10.10 tor(N1-C1'-C1'-N9)=-24.1
       H-bonds[3]: "O6(carbonyl)-N4(amino)[3.02]; N1(imino)-N3[3.07]; N2(amino)-O2(carbonyl)[2.91]"
       bp_pars: [-0.16   0.05    0.03    -1.64   -16.84  0.00]
  34 .D0A0.A.DC.7.    .D0A0.B.DG.14.   C-G WC           19-XIX    cWW cW-W
       -153.4(anti) C3'-endo lambda=56.2; -162.2(anti) C3'-endo lambda=54.8
       d(C1'-C1')=10.52 d(N1-N9)=8.85 d(C6-C8)=9.78 tor(N1-C1'-C1'-N9)=-15.6
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.67]; N3-N1(imino)[2.81]; N4(amino)-O6(carbonyl)[2.85]"
       bp_pars: [0.42    -0.26   -0.10   2.69    -7.28   0.66]
  35 .D0A0.A.DC.8.    .D0A0.B.DG.13.   C-G WC           19-XIX    cWW cW-W
       -170.0(anti) C3'-endo lambda=57.0; -178.7(anti) C2'-exo lambda=52.7
       d(C1'-C1')=10.66 d(N1-N9)=8.96 d(C6-C8)=9.90 tor(N1-C1'-C1'-N9)=-5.4
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.74]; N3-N1(imino)[2.96]; N4(amino)-O6(carbonyl)[3.06]"
       bp_pars: [0.53    -0.13   -0.14   2.56    -6.75   2.31]

****************************************************************************
List of 8 multiplet(s)
   1 nts=3 ..A.DG.4.+..B.DC.17.+.B00A.A.G.10. [GCG]
   2 nts=3 ..A.DC.7.+..B.DG.14.+.D000.B.G.20. [CGG]
   3 nts=3 ..A.G.10.+.B000.A.DG.4.+.B000.B.DC.17. [GGC]
   4 nts=3 ..B.G.20.+.D0A0.A.DC.7.+.D0A0.B.DG.14. [GCG]
   5 nts=4 ..A.C.1.+..B.G.20.+.D0A0.A.DG.6.+.D0A0.B.DC.15. [CGGC]
   6 nts=4 ..A.DG.3.+..B.DC.18.+.B00A.A.G.10.+.B00A.B.C.11. [GCGC]
   7 nts=4 ..A.DG.6.+..B.DC.15.+.D000.A.C.1.+.D000.B.G.20. [GCCG]
   8 nts=4 ..A.G.10.+..B.C.11.+.B000.A.DG.3.+.B000.B.DC.18. [GCGC]

****************************************************************************
List of 4 helices
  helix#1[1] bps=10
    helical-axis[2.39(0.56)]:   0.910  -0.336  -0.241
                   point-one:  -5.968   2.594  13.365
                   point-two:  13.332  -4.536   8.252
   1 ..A.C.1.         ..B.G.20.        C-G WC           19-XIX    cWW cW-W
   2 ..A.DC.2.        ..B.DG.19.       C-G WC           19-XIX    cWW cW-W
   3 ..A.DG.3.        ..B.DC.18.       G-C WC           19-XIX    cWW cW-W
   4 ..A.DG.4.        ..B.DC.17.       G-C WC           19-XIX    cWW cW-W
   5 ..A.DC.5.        ..B.DG.16.       C-G WC           19-XIX    cWW cW-W
   6 ..A.DG.6.        ..B.DC.15.       G-C WC           19-XIX    cWW cW-W
   7 ..A.DC.7.        ..B.DG.14.       C-G WC           19-XIX    cWW cW-W
   8 ..A.DC.8.        ..B.DG.13.       C-G WC           19-XIX    cWW cW-W
   9 ..A.DG.9.        ..B.DC.12.       G-C WC           19-XIX    cWW cW-W
  10 ..A.G.10.        ..B.C.11.        G-C WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  helix#2[1] bps=2
    helical-axis[2.74(0.03)]:  -0.920   0.389  -0.051
                   point-one:  14.406   1.922  -9.270
                   point-two:  11.887   2.987  -9.409
   1 .B000.A.DG.3.    .B000.B.DC.18.   G-C WC           19-XIX    cWW cW-W
   2 .B000.A.DG.4.    .B000.B.DC.17.   G-C WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  helix#3[1] bps=3
    helical-axis[3.74(0.22)]:  -0.798  -0.062   0.600
                   point-one:  -3.749  16.576   9.104
                   point-two:  -9.825  16.103  13.669
   1 .D0A0.A.DG.6.    .D0A0.B.DC.15.   G-C WC           19-XIX    cWW cW-W
   2 .D0A0.A.DC.7.    .D0A0.B.DG.14.   C-G WC           19-XIX    cWW cW-W
   3 .D0A0.A.DC.8.    .D0A0.B.DG.13.   C-G WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  helix#4[1] bps=2
    helical-axis[2.87(0.04)]:  -0.801   0.320  -0.506
                   point-one:  -0.996   2.525  29.487
                   point-two:  -3.291   3.441  28.036
   1 .B00A.A.DG.9.    .B00A.B.DC.12.   G-C WC           19-XIX    cWW cW-W
   2 .B00A.A.G.10.    .B00A.B.C.11.    G-C WC           19-XIX    cWW cW-W

****************************************************************************
List of 4 stems
  stem#1[#1] bps=10
    helical-axis[2.39(0.56)]:   0.910  -0.336  -0.241
                   point-one:  -5.968   2.594  13.365
                   point-two:  13.332  -4.536   8.252
   1 ..A.C.1.         ..B.G.20.        C-G WC           19-XIX    cWW cW-W
   2 ..A.DC.2.        ..B.DG.19.       C-G WC           19-XIX    cWW cW-W
   3 ..A.DG.3.        ..B.DC.18.       G-C WC           19-XIX    cWW cW-W
   4 ..A.DG.4.        ..B.DC.17.       G-C WC           19-XIX    cWW cW-W
   5 ..A.DC.5.        ..B.DG.16.       C-G WC           19-XIX    cWW cW-W
   6 ..A.DG.6.        ..B.DC.15.       G-C WC           19-XIX    cWW cW-W
   7 ..A.DC.7.        ..B.DG.14.       C-G WC           19-XIX    cWW cW-W
   8 ..A.DC.8.        ..B.DG.13.       C-G WC           19-XIX    cWW cW-W
   9 ..A.DG.9.        ..B.DC.12.       G-C WC           19-XIX    cWW cW-W
  10 ..A.G.10.        ..B.C.11.        G-C WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  stem#2[#2] bps=2
    helical-axis[2.74(0.03)]:  -0.920   0.389  -0.051
                   point-one:  14.406   1.922  -9.270
                   point-two:  11.887   2.987  -9.409
   1 .B000.A.DG.3.    .B000.B.DC.18.   G-C WC           19-XIX    cWW cW-W
   2 .B000.A.DG.4.    .B000.B.DC.17.   G-C WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  stem#3[#3] bps=3
    helical-axis[3.74(0.22)]:  -0.798  -0.062   0.600
                   point-one:  -3.749  16.576   9.104
                   point-two:  -9.825  16.103  13.669
   1 .D0A0.A.DG.6.    .D0A0.B.DC.15.   G-C WC           19-XIX    cWW cW-W
   2 .D0A0.A.DC.7.    .D0A0.B.DG.14.   C-G WC           19-XIX    cWW cW-W
   3 .D0A0.A.DC.8.    .D0A0.B.DG.13.   C-G WC           19-XIX    cWW cW-W
  --------------------------------------------------------------------------
  stem#4[#4] bps=2
    helical-axis[2.87(0.04)]:  -0.801   0.320  -0.506
                   point-one:  -0.996   2.525  29.487
                   point-two:  -3.291   3.441  28.036
   1 .B00A.A.DG.9.    .B00A.B.DC.12.   G-C WC           19-XIX    cWW cW-W
   2 .B00A.A.G.10.    .B00A.B.C.11.    G-C WC           19-XIX    cWW cW-W

****************************************************************************
List of 1 lone WC/wobble pair(s)
  -1 .D000.A.C.1.     .D000.B.G.20.    C-G WC           19-XIX    cWW cW-W

****************************************************************************
>100d.py-A #1 DNA[19]/RNA[5]* with 24 nts
CCGGCGCCGGGGCGCCGGGGCCGC
((((((((((((..(..(((((..
>100d.py-B #2 DNA[19]/RNA[6]* with 25 nts
CCGGCGCCGGCCGGGCCGGGCGGCC
))))))))))))..))).)))....

****************************************************************************
List of 5 additional files generated with this DSSR run
   1 dssr-stems.pdb -- MODEL/ENDMDL delineated stems
   2 dssr-helices.pdb -- MODEL/ENDMDL delineated helices (pseudo/coaxial)
   3 dssr-pairs.pdb -- MODEL/ENDMDL delineated base pairs
   4 dssr-multiplets.pdb -- MODEL/ENDMDL delineated multiplets
   5 dssr-torsions.dat -- Torsion angles and backbone(BI/BII) classification

Note the format of nt id string is now:
model-number.seqid.chain-id.nt-name.nt-number.insertion-code

Please have a try and report back how it goes.

Xiang-Jun

Pages: 1 ... 41 42 [43] 44 45 ... 65

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University