Messages

1051

RNA structures (DSSR) / Re: a little note about DSSR installation

« on: November 16, 2013, 08:40:52 am »

Hi Eugene,

Thanks for using DSSR and reporting back your findings on running the Cygwin version under native Windows environment. Did you install Cygwin and run the DSSR Cygwin version in that environment? Does DSSR run as expected there?

If you want to run DSSR directly under native Windows, the DSSR MinGW version is the way to go. See my post titled "DSSR works perfectly under DOS (in native Windows)". Please have a try, and report back how it goes.

DSSR is meant to be minimalistic, self-contained, without reliance on third-party libraries. Users just need to install the right version. I am interested in seeing counterexamples, and would take proper actions to ensure that DSSR is indeed self-contained.

HTH,

Xiang-Jun

1052

General discussions (Q&As) / Re: generating 10.5 bp/turn B-DNA

« on: November 11, 2013, 11:04:02 am »

Also regarding PHENIX, I never used that before. Actually I need to use this rebuilt structure for AMBER simulations so before molecular dynamics I will perform minimization with AMBER which should take care of geometric concerns. Do you still think that I should use PHENIX before AMBER minimization?

A nice feature about the PHENIX-restraint optimization is that one can fix the base geometry, and minimize the sugar-phosphate backbone only. AMBER should be perfectly fine, it is just that I do not know how to do it in detail. It helps if you could summarize the procedure for the benefit of other 3DNA/AMBER users.

Good luck!

Xiang-Jun

1053

General discussions (Q&As) / Re: generating 10.5 bp/turn B-DNA

« on: November 10, 2013, 09:13:34 pm »

Hi Jiomm,

Thanks for using 3DNA (w3DNA) and posting your questions on the Forum. The procedure you outlined sounds fine to me. Note that with the 3DNA rebuild program, you can generate an arbitrary structure with any prescribed sequence and associated base-pair and step (or helical) parameters. Since the process is rigorous and reversible, you will get the same parameters back if you analyze the generated structure. It is up to the user to decide whether the structure is meaningful in a particular context.

For your case, you could simply reset twist from 36 degrees to 34.29, while keeping other parameters fixed. I do not understand your rationale of changing rise from 3.37 Å to 3.5385 [i.e., the formula 3.37+ (3.37/2)/10 = 3.5385]. With your settings, the helical pitch is larger than the fiber B-DNA model.

Also note the rebuild structure may have irregular sugar-phosphate backbone connectivity, which can be 'regularized' with restraint optimization using PHENIX.

HTH,

Xiang-Jun

1054

RNA structures (DSSR) / DSSR release history

« on: October 31, 2013, 11:24:21 am »

As the list is becoming quite long, for easy reference, I have split up the DSSR release notes from the main post "DSSR: Dissecting the Spatial Structure of RNA". DSSR may be licensed from the Columbia Technology Ventures (CTV).

DSSR v2.6.0-2025jul24
Release notes since R24 funding

V1.x releases

• v1.9.10-2020apr23 -- added the nt_type field (with values "DNA", "RNA", or "unknown") to the nts array of JSON output, plus many code refactoring and feature revisions on DSSR-PyMOL schematics.
• v1.9.9-2020feb06 -- Added the --nt-mapping option so users can specify how modified nucleotides are mapped to their canonical counterparts. Please refer to the thread "modified nucleotides incorrect" initiated by tctcab on the 3DNA Forum. This update also contains many refinements at the DSSR-PyMOL interface for producing the characteristic block schematics. See http://skmatic.x3dna.org.
• v1.9.8-2019oct16 -- Added the --g4-onz option for ONZ classifications of G-tetrads in intramolecular G-quadruplexes, plus minor code refinements.
• v1.9.7-2019oct01 -- Fixed a bug in the identification of junction loops in special cases (as in PDB entry: 4wsm) -- thanks to lijun for reporting.
• v1.9.6-2019sep16 -- Revised the --get-hbond option, plus miscellaneous code/manual refinements.
• v1.9.5-2019aug01 -- Checked the compatibility of the --symm option with an NMR-ensemble-like input file where only the first model is handled; enhanced features on the analysis and output of G-quadruplexes; revised identification of duplex-G4 junctions (e.g., in 6r9k/6r9l).
• v1.9.4-2019jul08 -- Revised criteria for Watston-Crick pairs and improved identification of loops in rare cases. Updated the DSSR User Manual, which is now at 108 pages. Miscellaneous code refinements.
• v1.9.3-2019may25 -- Refined the code for command-line options; Added --block-opt (or --block-option) as an alternative for --block-file.
• v1.9.2-2019may06 -- Revised the algorithm for the alignment of G-tetrads along a G-helix. Now the left-handed G-quadruplex 6fq2 has a Twist angle of -25.8 degrees; Plus other minor code refinements.
• v1.9.1-2019apr06 -- Revised the --analyze-cehs option so that for non-WC structures it gives consistent results with the cehs program in 3DNA v2.4; added the output of a set of six "Simple helical parameters based on consecutive C1'-C1' vectors" with the --analyze option.
• v1.9.0-2019mar26 -- Added the --analyze option to output a list of key structural parameters as those from the 3DNA v2.x ‘analyze’ program. This option can also be specified as --3dna-v2, and it contains variations to fit other potential needs.

• v1.8.9-2019mar09 -- Revised algorithms for the identificaton of modified nucleotides, multiplets, and loops, in edge cases; expanded the definition of ~rHoogsteen pairs (e.g., G2-G12 in PDB entry 6ac7).
• v1.8.8-2019feb18 -- Relaxed criteria for reverse Hoogsteen (rHoogsteen) pairs; revised the algorithm for base identification in special cases.
• v1.8.7-2019feb11 -- Refined code and fixed a couple of bugs in rare occasions.
• v1.8.6-2019feb03 -- Refined the algorithm for H-bonds, plus documentation improvements and code refactoring.
• v1.8.5-2018nov29 -- Fixed the bug of not escaping backslash and double quote in DSSR JSON output.
• v1.8.4-2018nov12 -- (1) Further refinements of G-tetrad reference frame, leading to slightly revised twist angle. (2) Updated examples in command-line help text. (2) A few other minor revisions.
• v1.8.3-2018oct29 -- (1) Replaced raw C1' atomic coordinates with least-squares-fitted ones in the definition of G-tetrad reference frames. This switch ameliorates experimental uncertainty of C1' atomic coordinates, and is in line with the usage of the origins of G reference frames. As a result, helical parameters (Twist, Rise etc.) are slightly different from previously reported values. (2) Add a descriptive note for G4 stems that incorporates common names (including chair, basket, hybrid) and strand directionality, as in note=basket(2+2) for PDB id 2kf8. (3) Introduced a squared G-tetrad block of size 11.6 Å for visualization. (4) Added the --pair-only option to output just base-pairing info, which is 10 times faster than a default DSSR run. (5) Tightened the criteria of G-U Wobble pair. Now the U2586-G2592 pair in PDB id 1s72 is named ~Wobble. The pair has a Shear in the opposite direction of a normal Wobble pair, with two completely different H-bonds: N3(imino)*N2(amino)[3.05],O4(carbonyl)-N1(imino)[2.77]
• v1.8.2-2018oct20 -- Added detection of V-loops in G-quadruplexes, plus miscellaneous improvements.
• v1.8.1-2018oct09 -- Further refinements and expansions on the characterization of G-quadruplexes. (1) Added support of a consistent topological nomenclature for canonical G4 structures; (2) revised the algorithm for identifying G4 loops to allow for 0-nt propeller loop as in PDB entry 2m53; (3) recovered the missing G6+G10 pair in a distorted G-tetrad in PDB entry 148d; (4) implemented full JSON output of G4 structural features. DSSR is now full-fledged for the analysis and annotation of G-quadruplexes.
• v1.8.0-2018sep18 -- Significantly improved the characterization of G-quadruplexes, (1) revised the algorithm for the calculation of G-tetrad step parameters (twist/rise); (2) new features for the assignment of groove widths (medium, narrow, or wide), classification of stacking interactions based on the two faces of G-tetrads, and categorization of higher-order associations (coaxial stacking). Other refinements related to the identification of base-pairs and multiplets.

• v1.7.9-2018sep06 -- sped up further the analysis of NMR ensembles or MD trajectories; revised algorithms for identifying base pairs and multiplets in special cases; improved the mmCIF parser; plus minor code/manual refinements.
• v1.7.8-2018sep01 -- classified G-tetrads by different types of non-planarity; sped up analyses of large ensembles (--nmr) as the trajectories from MD simulations; introduced the "Linker" G+A base-pair name/type; revised the algorithm for H-bonding identification, plus numerous other minor code refactoring and refinements.
• v1.7.7-2018apr20 -- revised detection of multiplets in edge cases; miscellaneous minor refinements.
• v1.7.6-2018mar22 -- significantly refactored code for running multiple instances of DSSR in parallel; introduced the --auxfile=no option to bypass the generation of the auxiliary files; added three FAQ entries and a section on DSSR integrations to the manual.
• v1.7.5-2018mar19 -- revised code associated with the --blocview option for generating cartoon-block schematic images using PyMOL, in the most extended view; minor but fixes and code improvements.
• v1.7.4-2018jan30 -- revised the algorithm for H-bond detection, plus other minor code/manual improvements.
• v1.7.3-2017dec26 -- revised the JSON output of model/chain keys for consistency; incorporated abasic sites into analysis by default; revised code to avoid warning messages with GCC v7.
• v1.7.2-2017nov20 -- fixed a bug with abasic sites (as in PDB entry 4ifd, with --abasic), and a bug in the listing of modified nucleotides (as in PDB entry 2c4z in its biological assembly, with --symm); a variety of minor enhancements  of source code and the documentation.
• v1.7.1-2017nov01 -- fixed a bug in the analysis of G4-quadruplexes in rare cases; revised the characterization of i-motifs; checked this release on all nucleic-acid-containing structures in the PDB.
• v1.7.0-2017oct19 -- added a module to automatically identify and fully characterize G-quadruplexes, plus numerous other internal code refinements.

• v1.6.9-2017aug09 -- refined algorithms for identifying H-bonds and base pairs for boundary cases, plus miscellaneous code factoring and revisions.
• v1.6.8-2017mar28 -- fixed a bug in loop identification in edge cases (as in 4fe5); expanded standard bases to include A5 and A3 etc; fixed the 1-unit shift bug in the concatenated backbone suite string; fixed a bug in chain-specific DBN (as in 5pky); revised base-pair criteria to include C.U4--D.U4 pair in 1zh5; extended criteria for type=X A-minor-like motifs (U49 to U20--A76 in 4fe5); checked for output of non-stacked bases independently of stacked ones (as in 4rts); miscellaneous code/manual refinements.
• v1.6.7-2017mar14 -- fixed a bug in derived dot-bracket notation (DBN) with pseudoknots in special cases; revised --json to work with --get-hbonds for a full list of all H-bonds (DSSR and SNAP); changed type=O to type=X for eXtended A-minor motifs to avoid confusion with the previously documented type 0; lowered the default angle for splayed-apart dinucleotides from 100 degrees to 85; miscellaneous code/documentation refinements. 
  
• v1.6.6-2017feb20 -- extended A-minor motifs to include a miscellaneous type other than I and II; added groove widths to helices/stems and sequential number to nts of the JSON output; updated the user manual.
• v1.6.5-2017jan22 -- revised detection of pairs and helices/stems in rare cases; miscellaneous minor refinements.
• v1.6.4-2016nov19 -- refined detection of multiplets; added the characterization of terminal bases of helices/stems in the 'Summary' section; revised Jmol-DSSR web interface.
• v1.6.3-2016oct19 -- added a new section of splayed-apart dinucleotides and larger units; plus miscellaneous code refinements and minor bug fixes.
• v1.6.2-2016sep19 -- refined the algorithm for identifying kink-turns (K-turns), among many other internal improvements.
• v1.6.1-2016aug22 -- added the identification and characterization of i-motifs (e.g., 1a83 and 2n89); refined algorithms for the identification of H-bonds and helices; miscellaneous code refactoring.
• v1.6.0-2016aug06 -- added the --pair-list option to allow for user customizations of base pairs to be analyzed; added an analysis of the global curvature for each nucleic acid chain; plus various code refinements.

• v1.5.9-2016jul22 -- further refinements of the algorithm for H-bonding detection.
• v1.5.8-2016jul09 -- added a 'summary' line for each loop, plus miscellaneous code refinements.
• v1.5.7-2016jun16 -- refined the algorithm for H-bonding detection in corner cases (such as G-tetrads with poor geometry).
• v1.5.6-2016jun09 -- revised the summary line of DNA/RNA chains when multiple models are involved; consolidated/extended cartoob-block related functionality; internal code refinements and minor bug fixes.
• v1.5.5-2016may25 -- added the --view option (and related variants) to reset a structure via the principle moment of inertia, as in rotate_mol of 3DNA. The output orientation is in the most extended form, vertically; --blocview (or --block-view, --cartoon-block-view) option is also accepted to mimic the 3DNA blocview script; simplified the command-line help/examble message, and revised the user manual accordingly.
• v1.5.4-2016may16 -- significantly refined and extended the --frame option to reorient a structure based on a selected reference frame, including the middle frame of two base-pair frames, as in frame_mol of 3DNA; added output of the suite string in dssr-torsions.txt; minor bug fixed and refinements; updated user manual.
• v1.5.3-2016apr11 -- derived a set of virtual torsion angles using the phosphorus atoms and base origins (see output file dssr-torsions.txt). This set of P-base virtual torsions was first implemented in analyze -torsion of 3DNA v2.1, released in early 2012. See my blogpost titled "Pseudo-torsions to simplify the representation of DNA/RNA backbone conformation" (dated 2012-04-22) for details. Moreover, functions related to the --block-color option have been refined.
• v1.5.2-2016apr02 -- added the --block-color option to facilitate flexible color customizations of blocks/edges (e.g. minor groove); expanded the definition of junction loops to include the special case of a kissing loop motif mediated by an isolated canonical pair (e.g., 1ehz); various minor internal refinements.
• v1.5.1-2016mar11 -- miscellaneous code refinements and function enhancements.
• v1.5.0-2016feb12 -- removed the obsolete --jmol option since the DSSR-Jmol integration is now better served via JSON; added more styles in the cartoon-block representation.

• v1.4.9-2016jan25 -- fixed inconsistency in the dot-bracket-notation (dbn) output section regarding chain names with more than 1-char (as for 1vy6 in .cif format) -- thanks to Eugene for reporting the bug; refined .r3d output of base blocks for PyMOL rendering, following feedback from Thomas Holder.
• v1.4.8-2016jan16 -- refined the definition of extended base-pair names ("~Wobble", "~Hoogsteen", "~rHoogsteen", and "~Shear"); fixed a bug in the identification of G quartets in rare cases.
• v1.4.7-2016jan06 -- extended definition of base-pair names, with "~Wobble", "~Hoogsteen", "~rHoogsteen", and "~Shear" for corresponding pairs with similar geometry but sequences other than G–U, A+U, A–U, G–A, respectively.
• v1.4.6-2015dec16 -- refined detection of H-bonds, base-pairs, multiplets, and helices/stems for boundary cases.
• v1.4.5-2015nov23 -- added the --nar-paper option for rigorously reproducing the results reported in the 2015 DSSR Nucleic Acids Research paper; miscellaneous code refinements.
• v1.4.4-2015nov18 -- refined detection of base-pairs and multiplets in boundary cases; made the output of base-capping interactions by default (i.e., the --more option is no longer needed to be specified for its output).
• v1.4.3-2015oct23 -- added detection of metallo-base pairs, such as T-Hg-T (4l24) and C-Ag-C (5ay2) from the work of Kondo et al.
• v1.4.2-2015oct19 -- revised code for circular DNA or RNA molecules and unconventional glycosidic linkages (such as C1'–C1 for DY).
• v1.4.1-2015oct12 -- checked for potential erroneous usage of option --symmetry with an NMR ensemble (which leads to DSSR effectively taking the models all together); revised output width of id strings.
• v1.4.0-2015oct10 -- introduced the --nmr option to facilitate processing of NMR ensembles or trajectories of molecular dynamics simulations; added a new section summarizing structural features per nucleotide. Up to this point, DSSR contains all the fundamental features I have had in mind!

• v1.3.9-2015oct08 -- simplified diagnostic message, and refactored code.
• v1.3.8-2015oct02 -- added option --cartoon-block, plus a few minor refinements.
• v1.3.7-2015oct01 -- added option --symmetry (short form: --symm) to take symmetry-related MODEL/ENDMDL ensemble as a whole. This option is useful for x-ray crystal structures where the asymmetric unit is 'half' of the biological unit (e.g., PDB id: 467d -- x3dna-dssr -i=467d.pdb1 --symm).
• v1.3.6-2015sep18 -- revised JSON output for better DSSR-Jmol integration (thanks to Dr. Robert Hanson). Specifically, a "metadata" property is introduced to collect miscellaneous information, thus simplifying the top-level name space. Moreover, "ntParams" is renamed "nts" for consistency.
• v1.3.5-2015sep09 -- bug fixes for edge cases in JSON output, based on tests against all nucleic acid structures in PDB; minor code refactoring. The DSSR JSON output has now reached a stable, useable state.
• v1.3.4-2015sep06 -- fixed a bug in parsing .cif files as in PDB entry 5aj0 (thanks to Eugene for reporting the issue).
• v1.3.3-2015sep03 -- added output of reference frames of bases and base-pairs in JSON, exposing more of DSSR's functionality to other third-party tools (e.g., for visualization).
• v1.3.2-2015sep02 -- introduced a new set of "simple" base-pair (bp) parameters that are more intuitive for non-canonical bps. The simple parameters, including Shear, Stretch, Buckle and Propeller, are for structural description only, not suitable for model rebuilding. The non-planarity bp parameters, Buckle and Propeller in particular, have recently received attention in the RNA structure community. This simple set of bp parameter is provided to make DSSR more readily accessible to X-ray crystallographers or cryo-EM practitioners. The new parameters complement, but not replace, the original six rigid-body bp parameters for rigorous description and exact rebuilding of nucleic acid structures.
  
  When the --more option is specified, the new parameters are available in the main output file, taking an extra line for each bp. For --non-pair, the inter-base angle and minimum distance between base atoms are also listed. The new additions break backward compatibility of the main output file; use the --nar-paper option to stay with DSSR v1.2, as reported in the NAR article. Better yet, users are strongly encouraged to switch to the JSON output format for better connection with DSSR.
  
  
• v1.3.1-2015aug29 -- revised tag names for the --json output based on feedback from Dr. Wilma Olson; along the line, changed the file name dssr-a2bases.pdb to dssr-atom2bases.pdb to make its meaning more explicit for atom over base capping interactions.
• v1.3.0-2015aug27 -- added option --json to collect all DSSR-derived structural features in the standard JSON data exchange format. This single JSON file makes DSSR results easily parsable, allowing for its seamless integration with other RNA bioinformatics tools. Plus various other minor refinements.

• v1.2.9-2015jul25 -- added a new section on Reproducing results published in the DSSR-NAR paper to the 3DNA Forum, and documented corresponding auxiliary options in the User Manual.
• v1.2.8-2015jun15 -- added a new section titled "Additional options" to the User Manual; refined the algorithm for hydration identification.
• v1.2.7-2015jun09 -- added documentation of two related options: --prefix to customize the prefix of DSSR auxiliary files, and --cleanup to remove those files; other minor changes.
• v1.2.6-2015mar28 -- revised the interpretation of DSSR to "Dissecting the Spatial Structure of RNA"; added a new option --loop-isolated-pair to exclude isolated canonical pairs in delineating loops; updated the user manual (now 60 pages).
• v1.2.5-2015mar19 -- revised the helix/stem detection algorithm for circular DNA/RNA structures.
• v1.2.4-2015mar03 -- refined the algorithm for assigning dot-bracket notation (dbn) in rare cases, plus miscellaneous minor improvements.
• v1.2.3-2015feb18 -- improved the identification of multiplets.
• v1.2.2-2015feb06 -- refined the algorithm for assigning helices, plus several code refactoring and enhancements.
• v1.2.1-2015feb01 -- added the functionality for the "characterization of H-type pseudoknots"; refined the underlying algorithms for identifying H-bonds and base pairs.
• v1.2.0-2015jan01 -- numerous code refinements and refactoring; added classification of base-stacking interactions (option --non-pair); introduced the helix index that an isolated canonical pair is part of; included metal coordination bonds that phosphate OP1/OP2 atoms are involved in (option --po4); replaced option --long-idstr with --idstr; made option --nested explicit; added a new section on base stacks.

• v1.1.10-2014nov04 -- refined the algorithm for identifying multiplets; expanded option --non-pair to include all non-pairing interactions; various minor improvements.
• v1.1.9-2014oct22 -- refined H-bond identification and significantly fine-tuned base pair classification; updated the user manual.
• v1.1.8-2014oct09 -- fixed a bug in assigning G+A pairs to Saenger type X (10); further refined algorithms for finding H-bonds and base pairs.
• v1.1.7-2014sep24 -- added auxiliary files (where available) dssr-bulges.pdb, dssr-iloops.pdb and dssr-junctions.pdb to parallel dssr-hairpins.pdb; further refined the algorithm for H-bond detection; significantly improved the User Manual -- by switching to LaTeX, all the hyperlinks and cross references are active, and the excerpted output listings in the manual are auto-synced with the latest DSSR release via a Ruby script.
• v1.1.6-2014sep09 -- refined algorithms for detecting H-bonding and base-stacking interactions; removed the 4-line header in .bpseq output; checked for chain breaks in pseudoknot report; various code polishing.
• v1.1.5-2014aug28 -- added the section of atom-base stacking interactions (as in the case of the phosphate OP2 atom of G57 capping over the uracil ring of PSU55 in tRNA "1ehz"); significantly sped up the --non-pair and --phosphate options; miscellaneous code refinements.
• v1.1.4-2014aug09 -- added the option --nest to remove pseudo-knots (if any), leaving only nested pairs; added a new section to list modified nucleotides; numerous minor refinements.
• v1.1.3-2014jun18 -- refined the algorithm for deriving dot-bracket notation (.dbn) in RNA structures with higher-order pseudo knots (thanks to Jan Hajic); added secondary structure output in .bpseq format to parallel .ct and .dbn; miscellaneous code improvements.
• v1.1.2-2014apr19 -- added the option --torsion360 to output (virtual) torsional angle in the range of [0, 360] instead of the default range [-180, +180], following Cathy Lawson's suggestion; renamed "00-n/a" to "n/a" for unclassified Saenger pairs, plus a few other refinements of the User Manual based on feedback from Pascal Auffinger; revised A-minor separator character from '/' to '|' (i.e., from 'A/G-C' to 'A|G-C') based on communications with Bob Hanson.
• v1.1.1-2014apr11 -- added the option --get-hbonds to find and output all H-bonds in a structure; renamed file ‘dssr-torsions.dat’ to ‘dssr-torsions.txt’; updated the User Manual (50 pages)
• v1.1.0-2014apr09 -- denoted unnamed bps as '--' for easy parsing (thanks to feedback from Dr. Robert Hanson); added helical radius info for helices/stems, and made the helical rise parameter explicit (thanks to Dr. Wilma Olson); changed '_pars' to '-pars' in the output file for consistency; upgraded DSSR to v1.1.0-2014apr09 due to format changes.

• v1.0.6-2014apr04 -- revised the algorithm for detecting kissing loops, plus other minor refinements; updated the User Manual accordingly.
• v1.0.5-2014mar24 -- removed the --note option which has become redundant with notes in the main output file and the DSSR User Manual; shortened output from the --help option by deleting the 'Summary' section; minor code refinements. Added the overlooked subsection "Orientation of helices/stems" and fixed a few typos and inconsistencies in the User Manual (48 pages).
• v1.0.4-2014mar19 -- minor updates on notes in the main output file to synchronize with an significantly improved DSSR User Manual (46 pages) based on feedback from Dr. Wilma Olson.
• v1.0.3-2014mar09 -- various improvements for consistency, and finally and most importantly, the DSSR User Manual (45 pages) is out!
• v1.0.2-2014feb16 -- numerous minor refinements, mostly as a result of writing up the DSSR User Manual (coming soon!).
• v1.0.1-2014jan31 -- Refined the algorithm for detecting multiplets [thanks to Eugene]; fixed a bug for handling circular DNA/RNA structures [thanks to Pascal]; plus consistency improvements.
• v1.0-2014jan25 -- The program is robust and mature enough to warrant a v1.0 release. While DSSR will be continuously refined, top priority will be on bug fixes. Wherever practical, future DSSR v1.x releases will remain backward compatible.

Beta-testing releases

• beta-r30-on-20140118 -- considerably improved annotation and consistency of the main DSSR output file with help from Dr. Wilma Olson, refined algorithms for detecting internal and junction loops, added output of secondary structures in the connect (.ct) format and the extended DBN notation to allow for multiple molecules or fragments, removed the --break-symbol option. This will be the last beta release, and shortly we will move to DSSR v1.0! Please give it a try and let me know anything you'd like to change!
• beta-r29-on-20140106 -- significantly improved the algorithms for detecting various loops (hairpin, bulge, internal or junction loops), covering many corner cases. List of nucleotides in loops and single-stranded fragments are now presented consistently. Plus many code refinements.
• beta-r28-on-20131225 -- fixed a bug for missing 0-by-N type (right-side) bulge (thanks to Eugene).
• beta-r27-on-20131203 -- added the missing bracket ([) to delineate base-pair parameters in detailed output for helices/stems (thanks to Eugene).
• beta-r26-on-20131128 -- code refinements and refactoring, plus minor bug fixes. Single-stranded fragments now refer to nucleotides not involved in loops or canonical base-pairs (Watson-Crick and G-U wobble); simplified idstr for the non-standard compliant yet commonly encountered PDB files (mostly from MD simulations) with no chain id specified, from e.g. _.G1 to G1.
• beta-r25-on-20131119 -- added option --break-symbol to delineate chain breaks in dot-bracket notation; listed terminal single-stranded segments; plus code refinements/refactoring.
• beta-r24-on-20131030 -- refined code for nucleotide characterization; annotated the Levitt pair.
• beta-r23-on-20130918 -- bug fixes on U-turn identification and missing base pairs.
• beta-r22-on-20130910 -- minor bug fixes and code refinements; released the DSSR web-interface.
• beta-r21-on-20130903 -- fixed a rare bug reported by Pascal, and refined the mmCIF parsing code.
• beta-r20-on-20130830 -- added option --u-turn to detect UNR- or GNRA-type U-turns, plus numerous code refinements.
• beta-r19-on-20130819 -- added option --po4 (--phosphate) to list H-bonds involving phosphate groups; removed the segid info from nucleotide id-string by default;  refined code internally and fixed minor bugs.
• beta-r18-on-20130801 -- added support for the mmCIF format; refined code for parsing the PDB format.
• beta-r17-on-20130723 -- assigned backbone suite names (in file "dssr-torsion.dat") following Richardson et al. "RNA backbone: consensus all-angle conformers and modular string nomenclature"; numerous code refinements and note revisions.
• beta-r16-on-20130709 -- classified each dinucleotide step into A-, B- or Z-form conformation; simplified output by default. Users are advised to upgrade to this release.
• beta-r15-on-20130703 -- added output of base morphology parameters for each identified helix/stem.
• beta-r14-on-20130626 -- auto-detection of 'canonical' kink-turns (k-turns) and reverse k-turns (see my post "DSSR identifies kink-turns!"); numerous code refinements.
• beta-r13-on-20130618 -- added the PDB segment identifier (segid) into nucleotide id string; refine the algorithm for finding A-minor motifs.
• beta-r12-on-20130610 -- delineated the components of bulges, internal loops, and junctions, per user request.
• beta-r11-on-20130603 -- refined the descriptive note with the help of Dr. Wilma Olson; added the --long-idstr option to explicitly delineate fields of a residue id string for easy machine parsing; added the --pucker option to output the sugar pucker following either Altona & Sundaralingam (1972) or Westhof & Sundaralingam (1983) -- see the post "Two slightly different definitions of sugar pucker".
• beta-r10-on-20130430 -- added a brief descriptive note and a list of generated files to the main DSSR output; revised the command-line --help with more detailed usage info; improved output format, and refined code. Now DSSR is not only self-contained, but also (at least should be) self-explanatory.
• beta-r09-on-20130421 -- added a least-squares fitted helical axis for each identified helix/stem; classified the backbone into BI/BII conformations and the sugar into C2'/C3'-endo like (see file 'dssr-torsions.dat'); checked for non-pairing interactions (H-bonds or base stacking) with option '-non-pair'; refined code and revised output format
• beta-r08-on-20130323 -- refined algorithm for multiplet detection, revised the header section to output the numbers of DNA/RNA chains, nucleotides, waters, and metals
• beta-r07-on-20130322 -- code refinements, minor bug fixes, and more extensive tests
• beta-r06-on-20130319 -- fixed the "segmentation fault" bug reported by MarcParisien for PDB entry 2a64; revised -h message
• beta-r05-on-20130316 -- detection of ribose zippers; revision of help message; code refactoring
• beta-r04-on-20130314 -- detection of kissing loops; output format revisions, including an explicit listing of all nucleotides involved in hairpin loops; internal bug fixes and refinements
• beta-r03-on-20130309 -- extensive tests against all RNA/DNA-containing structures in the PDB as of March 2013, bug fixes and refinements
• beta-r02-on-20130306 -- bug fixes, and internal improvements
• beta-r01-on-20130303 -- initial release

1055

General discussions (Q&As) / Re: Wrapper for GROMACS MD trajectroy

« on: October 25, 2013, 10:25:46 am »

Hi Rajendra,

Thanks for your concrete response -- discussions at this level of details are more likely to be productive.

I was thinking that if I will able to pass coordinates and base-pair information directly to some C functions present in analyze, which in results would return all calculated parameters. At least, I can avoid writing and reading intermediate PDB files, and this process will speedup the wrapper execution.

I am willing to adapt the 3DNA analyze program to fit your needs. Could you please be more specific as to the input and output? I guess the input would be atomic coordinates in PDB format, and the base-pair info as from find_pair. Note that there are so many output parameters from an analyze run: some are for single-stranded structures, others are for historical reasons, and I doubt you need all of them. The basic idea is to start with something simple, and make it functional. Do you have a protocol as to what the analyze C functions should behave?

I have implemented two type of calculations. In first type,  find_pair executes only once at the start, and then same base-pairs information is used for whole calculation. However, during simulations, new base-pair may form and old may break, particularly in RNA. Therefore in second type, find_pair  executes at every frame, and output files are generated such that, one can easily able to get how base-pairs are forming and breaking.

I know that "during simulations, new base-pair may form and old may break". However, by using the same 'presumed' base-pair information, one can easily identify where bps break by virtue of weird parameters associated with them. I am not sure how to make a consistent comparison the other way around. Keep in mind that I am not a practitioner of MD simulations.

Xiang-Jun

1056

RNA structures (DSSR) / Re: dssr parameters

« on: October 17, 2013, 11:25:05 am »

Regarding the default values of the parameters, they are the same as in 3DNA 'misc_3dna.par' -- 4.0 Å for H-bond upper limit, 2.5 Å for vertical base separation, 15.0 Å for maximum distance between base origins, and 65° for maximum angle between base normals.

As for H-bonds, I used longer cut-offs for C-H...O bonds than for regular ones.
Usually for base pairs, I use the 3.35 and for C-H…O bonds, I add 0.5 Å to the preceding value.

DSSR uses a different strategy for C-H…O/N bonds and the criteria are more stringent than for the canonical H-bond. Note also that DSSR also identifies C-H…N bonds, just as for C-H…O bonds. I am more conservative in such non-canonical cases -- I was once even lectured about the existence of the O2′(G)…O2P(U) H-bond in the GpU dinucleotide platforms. Instead of arguing at the methodical level, I'd ask you to provide concrete examples where DSSR misses obvious C-H…O/N bonds.

While I am open to suggestions to make 3DNA/DSSR more generally applicable, I am very careful in selecting what to be put into the software that I support. To me, it is better to have extra easter eggs than claiming more than a piece of software can actually do. After all, only you know exactly what you are looking for. Understandably, DSSR does not necessarily fits all your requirements. Just use the parts you find useful, look elsewhere or develop your own tools to get the job done.

HTH

Xiang-Jun

1057

RNA structures (DSSR) / Re: dssr parameters

« on: October 17, 2013, 09:52:06 am »

Then you'd also use different distance cutoffs for Halogen bonding involving F, Cl, Br, and I. However, DSSR is first and foremost for deriving the secondary structure of RNA from three-dimensional coordinates. As we discussed before, 3DNA/DSSR is not a dedicated software for finding various H-bonds. Have you ever considered HBPLUS (http://www.ebi.ac.uk/thornton-srv/software/HBPLUS/), among other possible choices?

Xiang-Jun

1058

RNA structures (DSSR) / Re: dssr parameters

« on: October 16, 2013, 03:30:39 pm »

No need to set cut-off for C-H…N/O bond: DSSR uses a more stringent criteria for such H-bonds internally.

As a rule, please provide concrete examples: "That would be really awesome" than just making a general request. Where do you need a separate set of cut-offs for C-H containing H-bonds?

Xiang-Jun

1059

RNA structures (DSSR) / Re: dssr parameters

« on: October 16, 2013, 01:00:35 pm »

Parameters for defining bifurcated h-bonds,

No longer needed in DSSR which always finds bifurcated h-bonds.

The possibility to define atoms involved in h-bonding (O,N, or C)

Check the --chbond option (experimental)

The maximum vertical base separation (sorry for not having written the entire line down)

Already answered: --pair_vd2

The maximum angle between base normals
…
forgot the "#   maximum angle between base normals (in range 0..90)"

Check the --pair_angle2 option

The minimum distance between the RN/YN base atoms

No longer used.

HTH,

Xiang-Jun

1060

General discussions (Q&As) / Re: Wrapper for GROMACS MD trajectroy

« on: October 16, 2013, 12:19:04 pm »

I have developed a 3DNA wrapper in C language, which uses GROMACS library to read GROMACS format trajectory, topology and index file. This wrapper dumps frame-wise data to several text files. I guess, this tool will work for any format of MD trajectory such as AMBER, NAMD and CHARMM, but it is yet to be tested.

I appreciate your effort in building a 3DNA wrapper for the analysis of GROMACS MD trajectories. It'd be great if you can test and verify that it works for "MD trajectory such as AMBER, NAMD and CHARMM".

Additionally, I am developing Python APIs to analyze the vast amount of data obtained from the wrapper. It includes many useful methods to analyze properties of the DNA. One can analyze the changes in DNA upon binding to protein. Also, it can be used to calculate elastic properties of the DNA. Moreover, I have implemented few methods to analyze bending motions of helical axis.

If done right, a Python API on top of the wrapper will make the results of MD simulations readily accessible to a much larger community. I'd suggest you start from a small selection of key parameters, and build your tool incrementally.

I have a query. Since I am using C language for wrapper, may I get C APIs/library of 3DNA such that I can use directly these APIs in wrapper. Currently, I use find_pair and analyze executable binary. When I use wrapper for ~30,000 frames containing 60 BP DNA, it takes a while to complete and I want to speed up this calculation.

3DNA is composed of a few standalone commandline tools, and does not include a C APIs/library. However, I'd like to help you out where appropriate. Do you really need to run find_pair for each frame? See the output from running "x3dna_ensemble analyze -h". How long it takes approximately for running a MD simulation vs analyzing it?

I would like to release this tool through GitHub, however I am not sure that this work alone is of publication level. Please let me know, what would be your suggestion.

GitHub seems a good option. As for publishing such work, did you know the paper "PTRAJ and CPPTRAJ: Software for Processing and Analysis of Molecular Dynamics Trajectory Data" by Daniel Roe and Thomas Cheatham?

Best regards,

Xiang-Jun

1061

RNA structures (DSSR) / Re: dssr parameters

« on: October 16, 2013, 11:33:44 am »

Yes, 'misc_3dna.par' settings are mostly available in DSSR through command line. I've deliberately not documented them (plus quite a few new ones) in the current beta releases to ensure the defaults are working well for the majority of cases, and to make DSSR less overwhelming/intimidating to first time users. DSSR has more to offer than meets the eye.

Here are the ones you asked:

--pair_vd2   the vertical base separation
--pair_od2   the maximum distance between base origin

I do not understand what you mean by the following:

the maximum vertical separation

HTH,

Xiang-Jun

1062

General discussions (Q&As) / Re: Individual Model images in x3dna_ensemble block_image

« on: October 15, 2013, 05:46:07 pm »

A more logical option would be that you make your script available in the Users' contributions section. Other users then may benefit from your effort.

Xiang-Jun

1063

MD simulations / Re: DNA screwing into protein

« on: October 13, 2013, 03:13:58 pm »

Hi Vito,

Thanks for your kind words about 3DNA, and for sharing your experience on converting MD trajectories file to PDB format.

I would to study which is the rotation angle value of my whole DNA molecule that is in complex with a protein. basically I'm studying Polymerase, WT and Mutated one, to evaluate if that residue is really involved in. Whit the twist parameter i can't study it. Someone have any suggestion?

I am not quite sure what do you mean by "the rotation angle value" of your whole DNA molecule. Overall, it'd be case-specific as how to quantify changes in relative orientation between DNA molecules in wt vs mutated complexes. The 3DNA algorithm for calculating the base-pair step or helical parameters may be applicable, with a proper definition of coordinate frame.

Xiang-Jun

1064

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: October 11, 2013, 02:41:09 pm »

Well, for verification, I have just installed 3DNA v2.1 both Mac OS X and Linux 64-bit on my computer. The content of the bin/ directory is:

Code: [Select]

bin [522] ls
alc2img*        cehs*           find_pair*      mutate_bases*   rebuild*        std_base*       x3dna_utils*
analyze*        comb_str*       find_platform*  o1p_o2p*        regular_dna*    step_hel*
anyhelix*       ex_str*         frame_mol*      pdb2img*        rotate_mol*     x3dna_ensemble*
blocview*       fiber*          get_part*       r3d_atom*       stack2img*      x3dna_setup*

What OS do you have? Please install 3DNA v2.1 in a new directory, and make sure you have the same content as above. If so, then go to $X3DNA/examples/ensemble/md/ and follow README file there.

Xiang-Jun

1065

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: October 11, 2013, 09:28:49 am »

Hi Jorge,

You have not downloaded or installed 3DNA v2.1 correctly. The script is now called x3dna_ensemble. You seems not that familiar with the installation procedure. Please ask a local computer expert for help to get started.

Or, post back in details what you have done including the version of 3DNA you download, its location, your OS. Did you run x3dna_setup? What's the output? The point is reproducibility -- we must see exactly where your problems are to help you out.

Xiang-Jun

1066

General discussions (Q&As) / Re: Individual Model images in x3dna_ensemble block_image

« on: October 08, 2013, 08:52:17 pm »

Hi Andrew,

I am using the x3dna_ensemble program to process NMR and multi model structures.  When I use block_image I get as output a pdb and r3d of the entire ensemble, is it possible to get r3d output for each model using this method?

The resultant .pdb and .r3d files are as expected -- x3dna_ensemble works on an ensemble. To get separate .r3d, you can use the ex_str/blocview command pair for each model explicitly.

Regarding the difference between the following two runs:

x3dna_ensemble reorient -r "b" -e  in.pdb -o out_reorient_b.pdb
x3dna_ensemble reorient -v -e in.pdb -o out_reorient_e.pdb

See below for help message from x3dna_ensemble reorient -h. Basically, the option "-v (--bestview)" is a short-hand form for "-r 'cb' -k".

Code: [Select]

~ [516] x3dna_ensemble reorient -h
------------------------------------------------------------------------
Reorient models of a MODEL/ENDMDL delineated ensemble of NMR structures
or MD trajectories based on user specified base-pair reference frame or
rotation matrix. Coordinate transformation is perform by 'frame_mol' or
'rotate_mol'. Useful for 'local' structural alignment. The transformed
ensemble can be converted to an image using 'x3dna_ensemble block_image'
and visualized with Jmol or PyMOL.

Usage:
        x3dna_ensemble reorient options
Examples:
        x3dna_ensemble reorient -f 'm -6' -b bpfile.dat -e 2kei.pdb
             # reorient each model using the reference frame of bp #6
             #   with minor groove facing the viewer (-m)
             # options to -f must be quoted, where dash is optional
             #   generate 'model_list.dat', 'ensemble_example_trx.pdb'
        x3dna_ensemble reorient -f '8,9' -b bpfile.dat -e 2kei.pdb
             # reorient each model using the middle reference frame
             #   between base-pairs #8 and #9
        x3dna_ensemble reorient -v -e 2kei.pdb -o extended_view.pdb
             # transform the ensemble to its most extended view and
             #   keep the original relative orientation.
Options:
------------------------------------------------------------------------
    --bpfile, -b <s>:   Name of file containing base-pairing info
   --outfile, -o <s>:   Output file (default: ensemble_example_trx.pdb)
        --single, -s:   Single-stranded DNA/RNA
  --ensemble, -e <s>:   Ensemble delineated with MODEL/ENDMDL pairs
    --models, -m <s>:   File containing an explicit list of model numbers
   --pattern, -p <s>:   Pattern of model files to process (e.g., *.pdb)
      --list, -l <s>:   File containing an explicit list of models
    --rotate, -r <s>:   Options to be transfered to rotate_mol (quoted)
     --frame, -f <s>:   Options to be transfered to frame_mol (quoted)
          --keep, -k:   Keep the original relative orientation
      --bestview, -v:   Set to the most extended view; keep orientation
          --help, -h:   Show this message

HTH,

Xiang-Jun

1067

General discussions (Q&As) / Re: how to run 3dna scripts

« on: October 05, 2013, 10:38:44 pm »

Hi Jorge,

It is surprising that 3DNA v1.5 is still being used. As noted in the download page, this ancient version is no longer supported. You are advised to download v2.1, and follow the instruction "How to install 3DNA on Linux and Windows?" to get started. To verify your installation, and to get a better understanding of what 3DNA is about, please try to reproduce the results reported in the 2008 3DNA Nature Protocols paper.

HTH,

Xiang-Jun

1068

RNA structures (DSSR) / Re: dealing with symmetrics

« on: September 18, 2013, 03:17:13 pm »

Hi Pascal,

I've updated DSSR to beta-r23-on-20130918 on the download page. Please verify and report back if it fixes the problem you experienced.

As a general rule, it helps that users follow up timely on a case-by-case basis rather than post back only when they have a new request or meet another problem.

Xiang-Jun

1069

Feature requests / Re: Notification on format changes

« on: September 18, 2013, 11:28:27 am »

Hi Pascal,

I have split and moved this message from its initial thread on "dealing with symmetrics", since it stands out by itself.

Thanks for the suggestion. Overall, 3DNA v2.x is stable, and I'd be very careful in making any format changes. Form v2.0 and v2.1, the only significant change is the explicit specification of an input file to analyze, which makes the program behave consistently with other 3DNA programs.

As for DSSR, note that it is currently being released in beta. As such, I reserve the freedom to make any changes as I see fit. I normally document significant changes in the release note. It is up to the users to make changes accordingly in their scripts that employ DSSR. Now DSSR possesses features I originally have in mind, and it is becoming stable on its user interface. Moreover, it has laid a solid foundation for future work on RNA structures.

The 3DNA Forum currently has over 1150 registrations, and I do not intend to send a message to the list on every changes I make to DSSR/3DNA. As always, I will be quick in responding to any user questions on the Forum, including those related to format changes.

HTH,

Xiang-Jun

1070

RNA structures (DSSR) / Re: dealing with symmetrics

« on: September 16, 2013, 12:30:30 pm »

Hi Pascal,

Thanks for your following up. As of beta-r19-on-20130819, I have "removed the segid info from nucleotide id-string by default" (see the release note). As you already noticed, segid is not in PDB format v3, nor is it in PDBx/mmCIF. It thus makes sense to me to remove it from the DSSR default output, since it would empty in the majority of cases. However, you can get what to desire by specifying the --segid option explicitly.

HTH,

Xiang-Jun

1071

RNA structures (DSSR) / Re: issues in converting pdb to "dot bracket notation"

« on: September 14, 2013, 11:18:50 pm »

Hi Bhaskar,

Thanks for using DSSR and posting your question(s) on the Forum. The issue you noticed with DSSR-generated "dot bracket notation" for PDB entry 3q1q is as expected in its current implementation.

>3q1q-B #1 RNA* with 341 nts, in order
GGAGAGGAGCAGGCGGUCGCGGGGGCGCACACCUGCGCUCCCGAGGAAAGUCCGGACUCUGGAGCGGGGUGCCGGGUAACGCCCGGGAGGGGUGACCCUCGGACAGGGCCAUAGAGAAGAAGACCGCCCGGGGGGAAACUUCCGGGCAAGGGUGGAACGGUGGGGUAAGAGCCCACCAGCGUCGGGGCAACCCGGCGGCUUGGCAACCCCCACCUGGAGCAAGGCCAAGCAGGGGGUUGGGUCGCUCCCCUAUUCCCCCGGGUUGGCCGCUUGAGGUGUGCGGUAACGCACACCCCAGAUUGAUGACCGCCACAGAAUCCGGCUUAUGCUCCUCUCCCGUG
((((((((((..((((((.((((.(((((....))))).)))).(...((.((((((((([[[[[.((((((((((.....)))))(((((....)))))((...(((((.............(((((((((((....)))))))))..)).......((((((.......))))))(.(((((((....)))))))..).)))..)))))))))))))...[[[[.....{{{{...<<<..]]]]]>>>....}}}}.(((.]]]]......((((((((....))))))))..........))))))..)....)))))))...))))))))))....
>3q1q-C #2 RNA* with 82 nts, in order
GGCCAGGUAGCUCAGGGAGAGCACUGGAUAUGGGCACCCCCUAAGUCCAGGUGCGGCGGUUCGAUUCCGCCCCUGGCCACCA
(((((((..((((...[.)))).((((((..(((....)))...))))))....(((((..]....))))))))))))))).

Note the *s highlighted above, which signify breaks of nucleobases in the input structure. In DSSR, as in 3DNA, nucleotides are derived from base rings atoms in the PDB or PDBx/mmCIF file. As can be seen below, residue B.U39 in 3q1q has only ATOM records for the backbone (in red), but none for the base. You may want to check for yourself other such cases to account for the inconsistency in number of nts for chains B and C.

ATOM    810  P     C B  38      27.276 -44.145   9.394  1.00 80.00           P  
ATOM    811  OP1   C B  38      26.183 -43.184   9.115  1.00 80.00           O  
ATOM    812  OP2   C B  38      28.673 -43.648   9.404  1.00 80.00           O  
ATOM    813  O5'   C B  38      27.008 -44.858  10.808  1.00 80.00           O  
ATOM    814  C5'   C B  38      25.731 -45.392  11.179  1.00 80.00           C  
ATOM    815  C4'   C B  38      25.723 -45.968  12.591  1.00 80.00           C  
ATOM    816  O4'   C B  38      26.785 -46.947  12.768  1.00 80.00           O  
ATOM    817  C3'   C B  38      25.856 -44.974  13.744  1.00 80.00           C  
ATOM    818  O3'   C B  38      24.919 -45.259  14.795  1.00 80.00           O  
ATOM    819  C2'   C B  38      27.306 -45.149  14.194  1.00 80.00           C  
ATOM    820  O2'   C B  38      27.521 -44.843  15.559  1.00 80.00           O  
ATOM    821  C1'   C B  38      27.517 -46.640  13.943  1.00 80.00           C  
ATOM    822  N1    C B  38      28.967 -47.060  13.807  1.00 80.00           N  
ATOM    823  C2    C B  38      29.617 -47.732  14.873  1.00 80.00           C  
ATOM    824  O2    C B  38      29.007 -48.011  15.918  1.00 80.00           O  
ATOM    825  N3    C B  38      30.930 -48.076  14.726  1.00 80.00           N  
ATOM    826  C4    C B  38      31.592 -47.774  13.597  1.00 80.00           C  
ATOM    827  N4    C B  38      32.876 -48.136  13.507  1.00 80.00           N  
ATOM    828  C5    C B  38      30.960 -47.089  12.509  1.00 80.00           C  
ATOM    829  C6    C B  38      29.668 -46.754  12.659  1.00 80.00           C  
ATOM    830  P     U B  39      24.284 -44.122  15.737  1.00 80.00           P  
ATOM    831  OP1   U B  39      22.814 -44.315  15.717  1.00 80.00           O  
ATOM    832  OP2   U B  39      24.834 -42.793  15.370  1.00 80.00           O  
ATOM    833  O5'   U B  39      24.871 -44.473  17.192  1.00 80.00           O  
ATOM    834  C5'   U B  39      24.438 -45.584  17.981  1.00 80.00           C  
ATOM    835  C4'   U B  39      23.332 -45.180  18.944  1.00 80.00           C  
ATOM    836  C3'   U B  39      23.784 -44.467  20.213  1.00 80.00           C  
ATOM    837  O3'   U B  39      23.540 -43.056  20.125  1.00 80.00           O  
ATOM    838  P     U B  40      24.587 -41.959  20.658  1.00 80.00           P  
ATOM    839  OP1   U B  40      24.649 -42.089  22.135  1.00 80.00           O  
ATOM    840  OP2   U B  40      24.206 -40.655  20.068  1.00 80.00           O  
ATOM    841  O5'   U B  40      25.982 -42.393  19.987  1.00 80.00           O  
ATOM    842  C5'   U B  40      27.208 -42.521  20.704  1.00 80.00           C  
ATOM    843  C4'   U B  40      27.371 -43.944  21.208  1.00 80.00           C  
ATOM    844  O4'   U B  40      27.451 -44.862  20.086  1.00 80.00           O  
ATOM    845  C3'   U B  40      28.594 -44.204  22.075  1.00 80.00           C  
ATOM    846  O3'   U B  40      28.264 -44.010  23.462  1.00 80.00           O  
ATOM    847  C2'   U B  40      28.934 -45.657  21.747  1.00 80.00           C  
ATOM    848  O2'   U B  40      28.276 -46.605  22.568  1.00 80.00           O  
ATOM    849  C1'   U B  40      28.488 -45.807  20.289  1.00 80.00           C  
ATOM    850  N1    U B  40      29.577 -45.683  19.217  1.00 80.00           N  
ATOM    851  C2    U B  40      30.695 -46.550  19.196  1.00 80.00           C  
ATOM    852  O2    U B  40      30.963 -47.437  19.996  1.00 80.00           O  
ATOM    853  N3    U B  40      31.627 -46.340  18.195  1.00 80.00           N  
ATOM    854  C4    U B  40      31.522 -45.386  17.189  1.00 80.00           C  
ATOM    855  O4    U B  40      32.377 -45.290  16.317  1.00 80.00           O  
ATOM    856  C5    U B  40      30.350 -44.542  17.249  1.00 80.00           C  
ATOM    857  C6    U B  40      29.446 -44.715  18.228  1.00 80.00           C  

HTH,

Xiang-Jun

1072

General discussions (Q&As) / Re: Mac OS install problem

« on: September 10, 2013, 03:13:24 pm »

See "Protocol 1 - Install Instructions of 3DNA on a Mac". If you have further questions, please follow up that thread.

Note that the x3dna_setup script uses the 3DNA Linux tarball as an example. You should have downloaded a Mac OS X version.

Xiang-Jun

1073

General discussions (Q&As) / Re: hybrid analysis

« on: September 10, 2013, 10:04:04 am »

That's expected with the analyze program. DSSR provides a classification of each nucleic acid chain (DNA, RNA etc), which may be what you are looking for. Please be specific with a concrete example and tell us what you expect to find.

Xiang-Jun

1074

General discussions (Q&As) / Re: hybrid analysis

« on: September 09, 2013, 10:47:44 am »

3DNA should be able to automatically analyze a hybrid RNA/DNA structure. See section "(D) Automatic identification of double-helical regions in a DNA–RNA junction (Recipe no. 4, Box 2)" of the 2008 3DNA Nature Protocols paper.

Have a try on your structure, and report back any issues you may have.

Xiang-Jun

1075

w3DNA -- web interface to 3DNA / Re: O3'-P distance too long after reconstruction

« on: September 06, 2013, 05:13:48 pm »

Update on 2013-09-06: please see my post titled "Restraint optimization of DNA backbone geometry using PHENIX" for a PHENIX-based method to solve the long O3'-P distance problem.

Xiang-Jun