1
w3DNA -- web interface to 3DNA / changing secondary structure to tertiary structure of ssDNA
« on: March 22, 2012, 04:09:27 am »
Hi Xiang Jun,
I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na+ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.
How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance
Kumutha
I have a ssDNA sequence from 5' - 3' (TAATACGACTCACTATAGGGAATCCGTCGACGAATTCCCTATAGTGAGTCGTATTA). I have predicted the secondary structure using http://mfold.rna.albany.edu/?q=mfold/DNA-Folding-Form. I have set the ionic condition of Na+ as 0.1M and the folding temperature as 30 degree celsius. Here is the predicted secondary structure attached.
How do I change this secondary structure into tertiary structure using 3DNA web server? Or is there any way that I can do to get this tertiary structure from the sequence above? Thanks in advance

Kumutha
