Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.4 (DSSR Manual) · Homepage

Author Topic: DSSR: Dissecting the Spatial Structure of RNA  (Read 186234 times)

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1743
    • View Profile
    • 3DNA homepage
DSSR: Dissecting the Spatial Structure of RNA
« on: March 28, 2015, 12:42:38 pm »
As the number of experimentally solved RNA-containing structures grows, it is becoming increasingly important to characterize the geometric features of the molecules consistently and efficiently. Existing RNA bioinformatics tools are fragmented, and suffer in either scope or usability. DSSR, an integrated software tool for Dissecting the Spatial Structure of RNA, has been designed from ground up to streamline the analyses of three-dimensional RNA structures. This new program consolidates, refines, and significantly extends the functionality of 3DNA for RNA structural analysis.

Starting from an RNA structure in PDB or PDBx/mmCIF format, DSSR employs a set of simple geometric criteria to identify all existent base pairs (bp): either canonical Watson-Crick and wobble pairs or non-canonical pairs with at least one hydrogen bond. The latter pairs may include normal or modified bases, regardless of tautomeric or protonation state. DSSR uses the six standard rigid-body bp parameters (shear, stretch, stagger, propeller, buckle, and opening) to rigorously quantify the spatial disposition of any two interacting bases. Where applicable, the program also denotes a bp by common names, the Saenger classification scheme of 28 H-bonding types, and the Leontis-Westhof nomenclature of 12 basic geometric classes.

DSSR detects multiplets (triplets or higher-order base associations) by searching horizontally in the plane of the associated bp for further H-bonding interactions. The program determines double-helical regions by exploring vertically in the neighborhood of selected bps for base-stacking interactions, regardless of backbone connection (e.g., coaxial stacking of helices). DSSR then identifies hairpin loops, bulges, internal loops, and multi-branch loops (junctions), and recognizes the existence of pseudo-knots. The program outputs RNA secondary structure in dot-bracket notation (dbn), connectivity table (.ct) and CRW bpseq formats that can be fed directly into visualization tools (such as VARNA).

DSSR classifies dinucleotide steps into the most common A-, B-, or Z-form double helices, calculates commonly used backbone torsion angles, and assigns the consensus RNA backbone suite names. The program also identifies A-minor interactions, ribose zippers, G quartets, kissing loops, U-turns, and kink-turns. Furthermore, it reports non-pairing interactions (H-bonding or base-stacking) between two nucleotides, and contacts involving phosphate groups.

A simple web interface and a comprehensive user manual are available. Supported by Dr. Robert Hanson, DSSR has recently been integrated into Jmol, a popular molecular graphics program. DSSR-related news and information can be found on the 3DNA homepage. Questions and suggestions are always welcome on the 3DNA forum.

Give DSSR a try, compare it with similar tools in terms of usability, functionality and support, and see the differences!

As of version 2.0, DSSR has been licensed by Columbia University.


List of users who has helped improve DSSR by reporting bugs, making comments/suggestions etc:

jyvdf3asdg2; kailsen; MarcParisien; jctoledo; Auffinger; febos; acolasanti; hansonr; cllawson; Sylverlin; cigdem; lvelve0901; meier74; jms89; chemikeris; Bernhard10; rcsb_pdb; Marcel Heinz; lijun; tctcab; brinda.vallat

-- Xiang-Jun


Note: please start a new topic with a more specific title; do not post directly below this announcement.




Here are some sample runs (see x3dna-dssr -h for more info),
Code: [Select]
x3dna-dssr -i=1msy.pdb -o=1msy.out  # 27 nts
x3dna-dssr --input=1msy.pdb --output=1msy.out  # as as above
x3dna-dssr -i=1msy.pdb --json -o=1msy-dssr.json  # parameters exported in JSON format
x3dna-dssr -i=1ehz.pdb -o=1ehz.out  # tRNA, 76 nts
x3dna-dssr -i=1jj2.pdb -o=1jj2.out  # rRNA, 2876 nts

Example #1: GUAA tetraloop mutant of Sarcin/Ricin domain from E. Coli 23 S rRNA (1msy)

Code: [Select]
Run: x3dna-dssr -i=1msy.pdb --time-stamp=off -o=1msy.out --non-pair --u-turn
****************************************************************************
              DSSR: an Integrated Software Tool for
             Dissecting the Spatial Structure of RNA
             v1.9.10-2020apr23, by xiangjun@x3dna.org

DSSR has been made possible by the NIH grant R01GM096889 (to X.J.Lu).
It is being actively maintained and developed. As always, I greatly
appreciate your feedback. Please report all DSSR-related issues on
the 3DNA Forum (forum.x3dna.org). I strive to respond promptly to any
questions posted there. DSSR is free of charge for NON-COMMERCIAL
purposes, and it comes with ABSOLUTELY NO WARRANTY.

****************************************************************************
Note: By default, each nucleotide is identified by chainId.name#. So a
      common case would be B.A1689, meaning adenosine #1689 on chain B.
      One-letter base names for modified nucleotides are put in lower
      case (e.g., 'c' for 5MC). For further information about the output
      notation, please refer to the DSSR User Manual.
    Questions and suggestions are *always* welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1msy.pdb --u-turn --non-pair -o=1msy.out
File name: 1msy.pdb
    no. of DNA/RNA chains: 1 [A=27]
    no. of nucleotides:    27
    no. of atoms:          685
    no. of waters:         109
    no. of metals:         0

****************************************************************************
List of 13 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.U2647        A.G2673        U-G --          n/a       cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble      28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC          19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC          20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC          19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC          19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --          n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --          n/a       tHH  tM+M
   9 A.G2655        A.U2656        G+U Platform    n/a       cSH  cm+M
  10 A.U2656        A.A2665        U-A rHoogsteen  24-XXIV   tWH  tW-M
  11 A.A2657        A.G2664        A-G Sheared     11-XI     tHS  tM-m
  12 A.C2658        A.G2663        C-G WC          19-XIX    cWW  cW-W
  13 A.G2659        A.A2662        G-A Sheared     11-XI     tSH  tm-M

****************************************************************************
List of 1 multiplet
   1 nts=3 GUA A.G2655,A.U2656,A.A2665

****************************************************************************
List of 1 helix
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[1] bps=12
      strand-1 5'-UGCUCCUAUACG-3'
       bp-type    .|||||....|.
      strand-2 3'-GUGAGGCCAGGA-5'
      helix-form  ..AAA..x...
   1 A.U2647        A.G2673        U-G --           n/a       cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --           n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --           n/a       tHH  tM+M
   9 A.U2656        A.A2665        U-A rHoogsteen   24-XXIV   tWH  tW-M
  10 A.A2657        A.G2664        A-G Sheared      11-XI     tHS  tM-m
  11 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W
  12 A.G2659        A.A2662        G-A Sheared      11-XI     tSH  tm-M

****************************************************************************
List of 1 stem
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=5
      strand-1 5'-GCUCC-3'
       bp-type    |||||
      strand-2 3'-UGAGG-5'
      helix-form  .AAA
   1 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   2 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   3 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   4 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   5 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 30 non-pairing interactions
   1 A.U2647   A.G2648   stacking: 1.0(0.5)--pm(>>,forward) interBase-angle=6 connected min_baseDist=3.26
   2 A.G2648   A.C2649   stacking: 7.3(4.6)--pm(>>,forward) interBase-angle=5 connected min_baseDist=3.30
   3 A.G2648   A.G2673   stacking: 2.0(0.2)--mm(<>,outward) interBase-angle=2 min_baseDist=3.28
   4 A.C2649   A.U2650   stacking: 2.8(1.1)--pm(>>,forward) interBase-angle=9 connected min_baseDist=3.09
   5 A.U2650   A.C2651   stacking: 0.6(0.0)--pm(>>,forward) interBase-angle=7 connected min_baseDist=3.30
   6 A.C2651   A.C2652   stacking: 0.5(0.1)--pm(>>,forward) interBase-angle=12 connected min_baseDist=3.30
   7 A.C2652   A.U2653   stacking: 5.2(2.6)--pm(>>,forward) interBase-angle=13 connected min_baseDist=3.43
   8 A.C2652   A.G2669   stacking: 0.2(0.0)--mm(<>,outward) interBase-angle=7 min_baseDist=3.22
   9 A.U2653   A.A2654   stacking: 3.3(2.0)--pp(><,inward) interBase-angle=13 H-bonds[1]: "OP2-O2'(hydroxyl)[2.62]" connected min_baseDist=3.23
  10 A.A2654   A.U2656   stacking: 3.7(1.1)--mm(<>,outward) interBase-angle=1 H-bonds[1]: "O4'*O4'[3.05]" min_baseDist=3.45
  11 A.G2655   A.G2664   stacking: 4.4(2.2)--pp(><,inward) interBase-angle=10 H-bonds[2]: "O2'(hydroxyl)-O6(carbonyl)[3.09],O2'(hydroxyl)-N1(imino)[3.34]" min_baseDist=3.37
  12 A.G2655   A.A2665   interBase-angle=21 H-bonds[2]: "N1(imino)-OP2[2.77],N2(amino)-O5'[2.89]" min_baseDist=4.79
  13 A.U2656   A.G2664   interBase-angle=7 H-bonds[2]: "OP2-N1(imino)[3.04],OP2-N2(amino)[2.94]" min_baseDist=3.36
  14 A.A2657   A.C2658   stacking: 6.7(2.6)--pm(>>,forward) interBase-angle=4 connected min_baseDist=3.46
  15 A.A2657   A.A2665   stacking: 3.7(3.3)--mm(<>,outward) interBase-angle=11 min_baseDist=3.29
  16 A.C2658   A.G2659   stacking: 0.4(0.1)--pm(>>,forward) interBase-angle=10 connected min_baseDist=3.34
  17 A.G2659   A.A2661   interBase-angle=31 H-bonds[2]: "O2'(hydroxyl)-N7[2.60],O2'(hydroxyl)-N6(amino)[3.26]" min_baseDist=3.97
  18 A.G2659   A.G2663   stacking: 3.9(1.2)--mm(<>,outward) interBase-angle=4 min_baseDist=3.35
  19 A.U2660   A.A2661   stacking: 7.5(4.2)--pm(>>,forward) interBase-angle=17 connected min_baseDist=3.26
  20 A.A2661   A.A2662   stacking: 6.3(4.4)--pm(>>,forward) interBase-angle=19 connected min_baseDist=3.38
  21 A.G2663   A.G2664   stacking: 2.7(0.6)--pm(>>,forward) interBase-angle=8 connected min_baseDist=3.38
  22 A.G2664   A.A2665   interBase-angle=14 H-bonds[1]: "O2'(hydroxyl)-O4'[2.75]" connected min_baseDist=5.83
  23 A.A2665   A.C2666   stacking: 1.6(1.1)--pm(>>,forward) interBase-angle=10 connected min_baseDist=3.18
  24 A.C2666   A.C2667   stacking: 4.3(2.1)--pm(>>,forward) interBase-angle=8 connected min_baseDist=3.35
  25 A.C2667   A.G2668   stacking: 3.1(1.0)--pm(>>,forward) interBase-angle=7 connected min_baseDist=3.38
  26 A.G2668   A.G2669   stacking: 4.3(3.0)--pm(>>,forward) interBase-angle=4 connected min_baseDist=3.28
  27 A.G2669   A.A2670   stacking: 4.3(2.9)--pm(>>,forward) interBase-angle=4 connected min_baseDist=3.29
  28 A.A2670   A.G2671   stacking: 1.5(1.5)--pm(>>,forward) interBase-angle=6 connected min_baseDist=3.24
  29 A.G2671   A.U2672   stacking: 7.4(4.0)--pm(>>,forward) interBase-angle=10 connected min_baseDist=3.22
  30 A.U2672   A.G2673   interBase-angle=11 H-bonds[1]: "O2'(hydroxyl)-O4'[3.37]" connected min_baseDist=3.61

****************************************************************************
List of 5 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
   1 nts=2 GG A.G2648,A.G2673
   2 nts=3 UAA A.U2660,A.A2661,A.A2662
   3 nts=4 CUAU A.C2652,A.U2653,A.A2654,A.U2656
   4 nts=4 GGGG A.G2655,A.G2664,A.G2663,A.G2659
   5 nts=6 CAACCG A.C2658,A.A2657,A.A2665,A.C2666,A.C2667,A.G2668

****************************************************************************
List of 2 atom-base capping interactions
    dv: vertical distance of the atom above the nucleotide base
    -----------------------------------------------------------
     type       atom                 nt             dv
   1 phosphate  OP2@A.A2661          A.G2659        3.04
   2 sugar      O4'@A.G2664          A.G2663        3.48

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 1 hairpin loop
   1 hairpin loop: nts=6; [4]; linked by [#-1]
     summary: [1] 4 [A.2658 A.2663] 1
     nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
       nts=4 GUAA A.G2659,A.U2660,A.A2661,A.A2662

****************************************************************************
List of 1 internal loop
   1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#-1]
     summary: [2] 5 4 [A.2652 A.2668 A.2658 A.2663] 5 1
     nts=13 CUAGUACGGACCG A.C2652,A.U2653,A.A2654,A.G2655,A.U2656,A.A2657,A.C2658,A.G2663,A.G2664,A.A2665,A.C2666,A.C2667,A.G2668
       nts=5 UAGUA A.U2653,A.A2654,A.G2655,A.U2656,A.A2657
       nts=4 GACC A.G2664,A.A2665,A.C2666,A.C2667

****************************************************************************
List of 2 non-loop single-stranded segments
   1 nts=1 U A.U2647
   2 nts=1 G A.G2673

****************************************************************************
List of 1 U-turn
   1  A.G2659-A.A2662 H-bonds[2]: "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]" nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663

****************************************************************************
List of 1 splayed-apart dinucleotide
   1 A.G2659   A.U2660   angle=95     distance=13.2     ratio=0.74
----------------------------------------------------------------
Summary of 1 splayed-apart unit
   1 nts=2 GU A.G2659,A.U2660

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1msy nts=27 [whole]
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).
>1msy-A #1 nts=27 0.30(2.47) [chain] RNA
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).

****************************************************************************
Summary of structural features of 27 nucleotides
  Note: the first five columns are: (1) serial number, (2) one-letter
    shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base
    ring atoms fitted against those in a standard base reference
    frame. The sixth (last) column contains a comma-separated list of
    features whose meanings are mostly self-explanatory, except for:
      turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees
      break: no backbone linkage between O3'(i-1) and P(i)
   1  U . A.U2647   0.011  anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop
   2  G ( A.G2648   0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end
   3  C ( A.C2649   0.019  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
   4  U ( A.U2650   0.019  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
   5  C ( A.C2651   0.024  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
   6  C ( A.C2652   0.032  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop
   7  U . A.U2653   0.019  anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate
   8  A . A.A2654   0.019  anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop
   9  G . A.G2655   0.022  turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop
  10  U . A.U2656   0.020  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate
  11  A . A.A2657   0.023  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop
  12  C ( A.C2658   0.013  anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop
  13  G . A.G2659   0.033  u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart
  14  U . A.U2660   0.020  turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart
  15  A . A.A2661   0.015  u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate
  16  A . A.A2662   0.010  u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate
  17  G ) A.G2663   0.019  anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-acceptor
  18  G . A.G2664   0.014  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor
  19  A . A.A2665   0.014  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate
  20  C . A.C2666   0.016  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate
  21  C . A.C2667   0.029  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop
  22  G ) A.G2668   0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop
  23  G ) A.G2669   0.020  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  24  A ) A.A2670   0.019  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  25  G ) A.G2671   0.023  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  26  U ) A.U2672   0.024  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end
  27  G . A.G2673   0.010  anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop

****************************************************************************
List of 14 additional files
   1 dssr-pairs.pdb -- an ensemble of base pairs
   2 dssr-multiplets.pdb -- an ensemble of multiplets
   3 dssr-stems.pdb -- an ensemble of stems
   4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-iloops.pdb -- an ensemble of internal loops
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connectivity table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-splays.pdb -- an ensemble of splayed-apart units
  12 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  13 dssr-stacks.pdb -- an ensemble of stacks
  14 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions

Example #2: The crystal structure of yeast phenylalanine tRNA at 1.93 Å resolution (1ehz)

Code: [Select]
Run: x3dna-dssr -i=1ehz.pdb --time-stamp=off -o=1ehz.out --po4 --u-turn
****************************************************************************
              DSSR: an Integrated Software Tool for
             Dissecting the Spatial Structure of RNA
             v1.9.10-2020apr23, by xiangjun@x3dna.org

DSSR has been made possible by the NIH grant R01GM096889 (to X.J.Lu).
It is being actively maintained and developed. As always, I greatly
appreciate your feedback. Please report all DSSR-related issues on
the 3DNA Forum (forum.x3dna.org). I strive to respond promptly to any
questions posted there. DSSR is free of charge for NON-COMMERCIAL
purposes, and it comes with ABSOLUTELY NO WARRANTY.

****************************************************************************
Note: By default, each nucleotide is identified by chainId.name#. So a
      common case would be B.A1689, meaning adenosine #1689 on chain B.
      One-letter base names for modified nucleotides are put in lower
      case (e.g., 'c' for 5MC). For further information about the output
      notation, please refer to the DSSR User Manual.
    Questions and suggestions are *always* welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1ehz.pdb --u-turn --po4 -o=1ehz.out
File name: 1ehz.pdb
    no. of DNA/RNA chains: 1 [A=76]
    no. of nucleotides:    76
    no. of atoms:          1821
    no. of waters:         160
    no. of metals:         9 [Mg=6,Mn=3]

****************************************************************************
List of 11 types of 14 modified nucleotides
      nt    count  list
   1 1MA-a    1    A.1MA58
   2 2MG-g    1    A.2MG10
   3 5MC-c    2    A.5MC40,A.5MC49
   4 5MU-t    1    A.5MU54
   5 7MG-g    1    A.7MG46
   6 H2U-u    2    A.H2U16,A.H2U17
   7 M2G-g    1    A.M2G26
   8 OMC-c    1    A.OMC32
   9 OMG-g    1    A.OMG34
  10 PSU-P    2    A.PSU39,A.PSU55
  11 YYG-g    1    A.YYG37

****************************************************************************
List of 34 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C72          G-C WC          19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC          19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC          19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC          20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC          20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC          20-XX     cWW  cW-W
   8 A.U8           A.A14          U-A rHoogsteen  24-XXIV   tWH  tW-M
   9 A.U8           A.A21          U+A --          n/a       tSW  tm+W
  10 A.A9           A.A23          A+A --          02-II     tHH  tM+M
  11 A.2MG10        A.C25          g-C WC          19-XIX    cWW  cW-W
  12 A.2MG10        A.G45          g+G --          n/a       cHS  cM+m
  13 A.C11          A.G24          C-G WC          19-XIX    cWW  cW-W
  14 A.U12          A.A23          U-A WC          20-XX     cWW  cW-W
  15 A.C13          A.G22          C-G WC          19-XIX    cWW  cW-W
  16 A.G15          A.C48          G+C rWC         22-XXII   tWW  tW+W
  17 A.H2U16        A.U59          u+U --          n/a       tSW  tm+W
  18 A.G18          A.PSU55        G+P --          n/a       tWS  tW+m
  19 A.G19          A.C56          G-C WC          19-XIX    cWW  cW-W
  20 A.G22          A.7MG46        G-g --          07-VII    tHW  tM-W
  21 A.M2G26        A.A44          g-A Imino       08-VIII   cWW  cW-W
  22 A.C27          A.G43          C-G WC          19-XIX    cWW  cW-W
  23 A.C28          A.G42          C-G WC          19-XIX    cWW  cW-W
  24 A.A29          A.U41          A-U WC          20-XX     cWW  cW-W
  25 A.G30          A.5MC40        G-c WC          19-XIX    cWW  cW-W
  26 A.A31          A.PSU39        A-P --          n/a       cWW  cW-W
  27 A.OMC32        A.A38          c-A --          n/a       c.W  c.-W
  28 A.U33          A.A36          U-A --          n/a       tSH  tm-M
  29 A.5MC49        A.G65          c-G WC          19-XIX    cWW  cW-W
  30 A.U50          A.A64          U-A WC          20-XX     cWW  cW-W
  31 A.G51          A.C63          G-C WC          19-XIX    cWW  cW-W
  32 A.U52          A.A62          U-A WC          20-XX     cWW  cW-W
  33 A.G53          A.C61          G-C WC          19-XIX    cWW  cW-W
  34 A.5MU54        A.1MA58        t-a rHoogsteen  24-XXIV   tWH  tW-M

****************************************************************************
List of 4 multiplets
   1 nts=3 UAA A.U8,A.A14,A.A21
   2 nts=3 AUA A.A9,A.U12,A.A23
   3 nts=3 gCG A.2MG10,A.C25,A.G45
   4 nts=3 CGg A.C13,A.G22,A.7MG46

****************************************************************************
List of 2 helices
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[2] bps=15
      strand-1 5'-GCGGAUUcUGUGtPC-3'
       bp-type    ||||||||||||..|
      strand-2 3'-CGCUUAAGACACaGG-5'
      helix-form  AA....xAAAAxx.
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
   8 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   9 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
  10 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
  11 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
  12 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W
  13 A.5MU54        A.1MA58        t-a rHoogsteen   24-XXIV   tWH  tW-M
  14 A.PSU55        A.G18          P+G --           n/a       tSW  tm+W
  15 A.C56          A.G19          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  helix#2[2] bps=15
      strand-1 5'-AAPcUGGAgCUCAGu-3'
       bp-type    ...||||.||||...
      strand-2 3'-UcAGACCgCGAGUCU-5'
      helix-form  x..AAAAxAA.xxx
   1 A.A36          A.U33          A-U --           n/a       tHS  tM-m
   2 A.A38          A.OMC32        A-c --           n/a       cW.  cW-.
   3 A.PSU39        A.A31          P-A --           n/a       cWW  cW-W
   4 A.5MC40        A.G30          c-G WC           19-XIX    cWW  cW-W
   5 A.U41          A.A29          U-A WC           20-XX     cWW  cW-W
   6 A.G42          A.C28          G-C WC           19-XIX    cWW  cW-W
   7 A.G43          A.C27          G-C WC           19-XIX    cWW  cW-W
   8 A.A44          A.M2G26        A-g Imino        08-VIII   cWW  cW-W
   9 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
  10 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
  11 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
  12 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  13 A.A14          A.U8           A-U rHoogsteen   24-XXIV   tHW  tM-W
  14 A.G15          A.C48          G+C rWC          22-XXII   tWW  tW+W
  15 A.H2U16        A.U59          u+U --           n/a       tSW  tm+W

****************************************************************************
List of 4 stems
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=7
      strand-1 5'-GCGGAUU-3'
       bp-type    |||||||
      strand-2 3'-CGCUUAA-5'
      helix-form  AA....
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
  --------------------------------------------------------------------------
  stem#2[#2] bps=4
      strand-1 5'-gCUC-3'
       bp-type    ||||
      strand-2 3'-CGAG-5'
      helix-form  AA.
   1 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
   2 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
   3 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
   4 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#3[#2] bps=4
      strand-1 5'-CCAG-3'
       bp-type    ||||
      strand-2 3'-GGUc-5'
      helix-form  AAA
   1 A.C27          A.G43          C-G WC           19-XIX    cWW  cW-W
   2 A.C28          A.G42          C-G WC           19-XIX    cWW  cW-W
   3 A.A29          A.U41          A-U WC           20-XX     cWW  cW-W
   4 A.G30          A.5MC40        G-c WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#4[#1] bps=5
      strand-1 5'-cUGUG-3'
       bp-type    |||||
      strand-2 3'-GACAC-5'
      helix-form  AAAA
   1 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   2 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
   3 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
   4 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
   5 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.G19          A.C56          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 2 coaxial stacks
   1 Helix#1 contains 2 stems: [#1,#4]
   2 Helix#2 contains 2 stems: [#3,#2]

****************************************************************************
List of 11 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
   1 nts=2 Uc A.U7,A.5MC49
   2 nts=2 UC A.U8,A.C13
   3 nts=2 GA A.G65,A.A66
   4 nts=3 CgC A.C25,A.M2G26,A.C27
   5 nts=3 gAC A.7MG46,A.A21,A.C48
   6 nts=3 GtP A.G53,A.5MU54,A.PSU55
   7 nts=4 GACC A.G1,A.A73,A.C74,A.C75
   8 nts=4 GAcU A.G30,A.A31,A.OMC32,A.U33
   9 nts=5 GGGaC A.G19,A.G57,A.G18,A.1MA58,A.C61
  10 nts=7 gAAgAPc A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
  11 nts=9 GAGAGAGUC A.G43,A.A44,A.G45,A.A9,A.G22,A.A14,A.G15,A.U59,A.C60

****************************************************************************
Nucleotides not involved in stacking interactions
     nts=4 uGUA A.H2U17,A.G20,A.U47,A.A76

****************************************************************************
List of 4 atom-base capping interactions
    dv: vertical distance of the atom above the nucleotide base
    -----------------------------------------------------------
     type       atom                 nt             dv
   1 phosphate  OP2@A.H2U16          A.H2U16        2.59
   2 phosphate  OP2@A.A35            A.U33          2.85
   3 sugar      O4'@A.U59            A.C48          3.10
   4 phosphate  OP2@A.G57            A.PSU55        2.90

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 3 hairpin loops
   1 hairpin loop: nts=10; [8]; linked by [#2]
     summary: [1] 8 [A.13 A.22] 4
     nts=10 CAGuuGGGAG A.C13,A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21,A.G22
       nts=8 AGuuGGGA A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21
   2 hairpin loop: nts=11; [9]; linked by [#3]
     summary: [1] 9 [A.30 A.40] 4
     nts=11 GAcUgAAgAPc A.G30,A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
       nts=9 AcUgAAgAP A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39
   3 hairpin loop: nts=9; [7]; linked by [#4]
     summary: [1] 7 [A.53 A.61] 5
     nts=9 GtPCGaUCC A.G53,A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60,A.C61
       nts=7 tPCGaUC A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60

****************************************************************************
List of 1 junction
   1 4-way junction: nts=16; [2,1,5,0]; linked by [#1,#2,#3,#4]
     summary: [4] 2 1 5 0 [A.7 A.66 A.10 A.25 A.27 A.43 A.49 A.65] 7 4 4 5
     nts=16 UUAgCgCGAGgUCcGA A.U7,A.U8,A.A9,A.2MG10,A.C25,A.M2G26,A.C27,A.G43,A.A44,A.G45,A.7MG46,A.U47,A.C48,A.5MC49,A.G65,A.A66
       nts=2 UA A.U8,A.A9
       nts=1 g A.M2G26
       nts=5 AGgUC A.A44,A.G45,A.7MG46,A.U47,A.C48
       nts=0

****************************************************************************
List of 1 non-loop single-stranded segment
   1 nts=4 ACCA A.A73,A.C74,A.C75,A.A76

****************************************************************************
List of 1 kissing loop interaction
   1 isolated-pair #-1 between hairpin loops #1 and #3

****************************************************************************
List of 2 U-turns
   1  A.U33-A.A36 H-bonds[1]: "N3(imino)-OP2[2.80]" nts=6 cUgAAg A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37
   2  A.PSU55-A.1MA58 H-bonds[1]: "N3(imino)-OP2[2.77]" nts=6 tPCGaU A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59

****************************************************************************
List of 18 phosphate interactions
   1 A.U7      OP1-hbonds[1]: "MG@A.MG580[2.60]"
   2 A.A9      OP2-hbonds[1]: "N4@A.C13[3.01]"
   3 A.A14     OP2-hbonds[1]: "MG@A.MG580[1.93]"
   4 A.H2U16   OP2-cap: "A.H2U16"
   5 A.G18     OP1-hbonds[1]: "O2'@A.H2U17[2.97]"
   6 A.G19     OP1-hbonds[2]: "N4@A.C60[3.27],MN@A.MN530[2.19]"
   7 A.G20     OP1-hbonds[1]: "MG@A.MG540[2.07]"
   8 A.A21     OP2-hbonds[1]: "MG@A.MG540[2.11]"
   9 A.A23     OP2-hbonds[1]: "N6@A.A9[3.12]"
  10 A.A35     OP2-cap: "A.U33"
  11 A.A36     OP2-hbonds[1]: "N3@A.U33[2.80]"
  12 A.YYG37   OP2-hbonds[1]: "MG@A.MG590[2.53]"
  13 A.C48     OP2-hbonds[1]: "O2'@A.7MG46[3.55]"
  14 A.5MC49   OP1-hbonds[1]: "O2'@A.C48[3.13]" OP2-hbonds[1]: "O2'@A.U7[2.68]"
  15 A.U50     OP1-hbonds[1]: "O2'@A.U47[2.71]"
  16 A.G57     OP2-cap: "A.PSU55"
  17 A.1MA58   OP2-hbonds[1]: "N3@A.PSU55[2.77]"
  18 A.C60     OP1-hbonds[1]: "N4@A.C61[3.12]" OP2-hbonds[1]: "O2'@A.1MA58[2.42]"

****************************************************************************
List of 9 splayed-apart dinucleotides
   1 A.U7     A.U8     angle=127    distance=17.2     ratio=0.90
   2 A.H2U16  A.H2U17  angle=146    distance=19.5     ratio=0.96
   3 A.H2U17  A.G18    angle=106    distance=15.8     ratio=0.80
   4 A.G19    A.G20    angle=130    distance=16.8     ratio=0.91
   5 A.7MG46  A.U47    angle=139    distance=19.0     ratio=0.94
   6 A.U47    A.C48    angle=157    distance=19.7     ratio=0.98
   7 A.C48    A.5MC49  angle=148    distance=17.5     ratio=0.96
   8 A.C60    A.C61    angle=91     distance=13.8     ratio=0.71
   9 A.C75    A.A76    angle=160    distance=18.7     ratio=0.98
----------------------------------------------------------------
Summary of 6 splayed-apart units
   1 nts=2 UU A.U7,A.U8
   2 nts=3 uuG A.H2U16,A.H2U17,A.G18
   3 nts=2 GG A.G19,A.G20
   4 nts=4 gUCc A.7MG46,A.U47,A.C48,A.5MC49
   5 nts=2 CC A.C60,A.C61
   6 nts=2 CA A.C75,A.A76

****************************************************************************
This structure contains 1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ehz nts=76 [whole]
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
>1ehz-A #1 nts=76 0.09(2.86) [chain] RNA
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

****************************************************************************
Summary of structural features of 76 nucleotides
  Note: the first five columns are: (1) serial number, (2) one-letter
    shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base
    ring atoms fitted against those in a standard base reference
    frame. The sixth (last) column contains a comma-separated list of
    features whose meanings are mostly self-explanatory, except for:
      turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees
      break: no backbone linkage between O3'(i-1) and P(i)
   1  G ( A.G1     0.008  anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack
   2  C ( A.C2     0.006  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   3  G ( A.G3     0.021  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   4  G ( A.G4     0.018  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   5  A ( A.A5     0.018  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   6  U ( A.U6     0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   7  U ( A.U7     0.008  anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart
   8  U . A.U8     0.016  anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart
   9  A . A.A9     0.032  anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate
  10  g ( A.2MG10  0.018  modified,turn,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop
  11  C ( A.C11    0.005  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  12  U ( A.U12    0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet
  13  C ( A.C13    0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop
  14  A . A.A14    0.025  anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate
  15  G . A.G15    0.021  anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop
  16  u . A.H2U16  0.188  modified,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,cap-donor,cap-acceptor,phosphate,splayed-apart
  17  u . A.H2U17  0.201  modified,turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart
  18  G . A.G18    0.028  anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate,splayed-apart
  19  G [ A.G19    0.026  pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate,splayed-apart
  20  G . A.G20    0.018  anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart
  21  A . A.A21    0.018  anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate
  22  G ) A.G22    0.017  anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop
  23  A ) A.A23    0.030  anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate
  24  G ) A.G24    0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  25  C ) A.C25    0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop
  26  g . A.M2G26  0.013  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop
  27  C ( A.C27    0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop
  28  C ( A.C28    0.007  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  29  A ( A.A29    0.019  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  30  G ( A.G30    0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop
  31  A . A.A31    0.007  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop
  32  c . A.OMC32  0.008  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop
  33  U . A.U33    0.014  u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor
  34  g . A.OMG34  0.021  modified,turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop
  35  A . A.A35    0.006  u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate
  36  A . A.A36    0.015  u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate
  37  g . A.YYG37  0.015  modified,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate
  38  A . A.A38    0.008  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop
  39  P . A.PSU39  0.004  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop
  40  c ) A.5MC40  0.005  modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop
  41  U ) A.U41    0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  42  G ) A.G42    0.010  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  43  G ) A.G43    0.025  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop
  44  A . A.A44    0.015  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop
  45  G . A.G45    0.026  anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop
  46  g . A.7MG46  0.022  modified,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart
  47  U . A.U47    0.007  turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart
  48  C . A.C48    0.015  turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate,splayed-apart
  49  c ( A.5MC49  0.020  modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart
  50  U ( A.U50    0.024  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate
  51  G ( A.G51    0.030  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  52  U ( A.U52    0.020  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  53  G ( A.G53    0.027  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop
  54  t . A.5MU54  0.010  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop
  55  P . A.PSU55  0.024  modified,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor
  56  C ] A.C56    0.014  pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop
  57  G . A.G57    0.017  u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate
  58  a . A.1MA58  0.012  modified,u-turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate
  59  U . A.U59    0.029  turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,cap-donor
  60  C . A.C60    0.016  anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart
  61  C ) A.C61    0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,splayed-apart
  62  A ) A.A62    0.016  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  63  C ) A.C63    0.016  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  64  A ) A.A64    0.014  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  65  G ) A.G65    0.017  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop
  66  A ) A.A66    0.016  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop
  67  A ) A.A67    0.020  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  68  U ) A.U68    0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  69  U ) A.U69    0.015  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  70  C ) A.C70    0.018  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  71  G ) A.G71    0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  72  C ) A.C72    0.006  anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack
  73  A . A.A73    0.010  anti,~C3'-endo,BI,non-pair-contact,ss-non-loop
  74  C . A.C74    0.007  anti,~C3'-endo,BI,non-pair-contact,ss-non-loop
  75  C . A.C75    0.007  anti,~C3'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart
  76  A . A.A76    0.010  anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,splayed-apart

****************************************************************************
List of 14 additional files
   1 dssr-pairs.pdb -- an ensemble of base pairs
   2 dssr-multiplets.pdb -- an ensemble of multiplets
   3 dssr-stems.pdb -- an ensemble of stems
   4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch)
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connectivity table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-splays.pdb -- an ensemble of splayed-apart units
  12 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  13 dssr-stacks.pdb -- an ensemble of stacks
  14 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions

Note: shown above, the 3-dimensional schematic images (with rectangular base blocks) were created with the 3DNA blocview program to generate .r3d-formatted files that were ray-traced using PyMOL. The 2-dimensional diagrams were produced with VARNA: Visualization Applet for RNA using DSSR-derived base sequence and dot-bracket notation of secondary structure:
Code: [Select]
>1msy-A #1 RNA with 27 nts
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).

>1ehz-A #1 RNA with 76 nts
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGuPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
« Last Edit: March 31, 2022, 10:35:13 am by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University