Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.6.0 (DSSR Manual) · Homepage

Author Topic: A pair is absent in dot-bracket notation ?  (Read 116995 times)

Offline sk

  • non-commercial
  • with-posts
  • *
  • Posts: 5
    • View Profile
A pair is absent in dot-bracket notation ?
« on: November 24, 2023, 12:21:42 pm »
Hello,

when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.

Here is a copy of the output.

Code: [Select]
           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C21          G-C WC          19-XIX    cWW  cW-W
   2 A.G2           A.C20          G-C WC          19-XIX    cWW  cW-W
   3 A.C3           A.G19          C-G WC          19-XIX    cWW  cW-W
   4 A.G4           A.U18          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.U5           A.A17          U-A WC          20-XX     cWW  cW-W
   6 A.A7           A.U16          A-U --          --        cWW  cW-W
   7 A.G8           A.C15          G-C WC          19-XIX    cWW  cW-W
   8 A.G9           A.C14          G-C WC          19-XIX    cWW  cW-W

****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))

****************************************************************************


Offline sk

  • non-commercial
  • with-posts
  • *
  • Posts: 5
    • View Profile
Re: A pair is absent in dot-bracket notation ?
« Reply #1 on: November 24, 2023, 04:54:00 pm »
Ok, I think I understood now.

in dbn we have only Watson-Crick and wobble G–U pairs.

Thanks:)

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1708
    • View Profile
    • 3DNA homepage
Re: A pair is absent in dot-bracket notation ?
« Reply #2 on: November 25, 2023, 12:01:52 am »
Hi,

Thanks for using DSSR, and for asking questions with specifics and for your followup.

6 A.A7           A.U16          A-U --           --        cWW  cW-W

Base-pair #6 is Watson-Crick like, but not a WC A-U pair, due to unconventional H-bonding patterns, as detailed below:

       [-153.4(anti) ~C3'-endo lambda=53.9] [-160.2(anti) ~C3'-endo lambda=88.0]
       d(C1'-C1')=10.02 d(N1-N9)=9.09 d(C6-C8)=10.56 tor(C1'-N1-N9-C1')=-7.1
       H-bonds[1]: "N1*O2(carbonyl)[2.91]"
       interBase-angle=12  Simple-bpParams: Shear=-2.57 Stretch=1.35 Buckle=9.9 Propeller=-7.0
       bp-pars: [-2.83   0.63    0.93    11.39   -4.17   30.82]


The DBN notation is for classic 2nd stratucure with WC and G-U wobble pairs.

Best regards,

Xiang-Jun

Offline sk

  • non-commercial
  • with-posts
  • *
  • Posts: 5
    • View Profile
Re: A pair is absent in dot-bracket notation ?
« Reply #3 on: September 04, 2024, 04:26:40 pm »
Another question in the same topic.

If I run "x3dna-dssr  --more -i=pdb-data/8SH5.cif" it says

Code: [Select]
...
  17 R.G19          R.C49          G-C WC          19-XIX    cWW  cW-W
       [-155.1(anti) ~C3'-endo lambda=50.2] [-106.9(anti) ~C2'-endo lambda=53.7]
       d(C1'-C1')=10.82 d(N1-N9)=9.00 d(C6-C8)=9.90 tor(C1'-N1-N9-C1')=-11.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]"
       interBase-angle=8  Simple-bpParams: Shear=-0.21 Stretch=-0.13 Buckle=-2.1 Propeller=-7.6
...

But in dbn, there is no parentheses on these positions (19 and 49). Why? Maybe because of a non-canonical pair have G19-C51 or G19-G22  ?
Do you discard a canonical pair (x,y) if there is a non-canonical one (x,z) with z < y ?

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1708
    • View Profile
    • 3DNA homepage
Re: A pair is absent in dot-bracket notation ?
« Reply #4 on: September 05, 2024, 11:10:22 pm »
Pay attention to the following section:

# x3dna-dssr -i=8SH5.pdb

  stem#3[#2, #3]* bps=2 parallel
      strand-1 5'-GG-3'
       bp-type    ||
      strand-2 5'-CC-3'
      helix-form  .
   1 R.G19          R.C49          G-C WC           19-XIX    cWW  cW-W
   2 R.G20          R.C50          G-C WC           19-XIX    cWW  cW-W


These two WC pairs form a parallel mini-duplex. Both pairs (not just G19-C49 but also G20-C50) are excluded from the DBN notation.

Best regards,

Xiang-Jun
« Last Edit: September 05, 2024, 11:43:19 pm by xiangjun »

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University