Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.0 (DSSR Manual) · Homepage · HIRING!

Author Topic: Adding missing residue in PDB file of RNA  (Read 61468 times)

Offline sunil10654

  • with-posts
  • *
  • Posts: 2
    • View Profile
Adding missing residue in PDB file of RNA
« on: February 08, 2017, 11:09:32 am »
Hello Everyone,


I have a PDB file for RNA. Co-ordinates of 8 nucleotide residues are missing in the pdb file. I know the missing sequence of residues. I need the co-ordinates of complete RNA sequence. Can I add the missing residue and create a modified PDB file of complete sequence using x3DNA ?


Sequence :  GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAA
UCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGG--(AUGCUUGU)--CCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA

The region in bracket is missing in PDB file.

Requirement : PDB file of complete sequence.
Thanks.
« Last Edit: February 08, 2017, 11:12:31 am by sunil10654 »

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1736
    • View Profile
    • 3DNA homepage
Re: Adding missing residue in PDB file of RNA
« Reply #1 on: February 08, 2017, 11:25:46 am »
Hi,

I understand what you mean. Unfortunately, 3DNA currently do not have the direct means to fit your need. The rebuild and mutate_bases programs in 3DNA all need a starting structure to manipulate. RNA model building, like in your case, is an area of future direction of 3DNA.

You may find NAB from the Case group useful. There are also some other dedicated RNA modeling tools, as shown in RNA-Puzzles. Please let us know how things go.

Best regards,

Xiang-Jun
« Last Edit: February 08, 2017, 11:27:58 am by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline sunil10654

  • with-posts
  • *
  • Posts: 2
    • View Profile
Re: Adding missing residue in PDB file of RNA
« Reply #2 on: February 08, 2017, 11:30:00 am »
Dear xiangjun,

Thanks for your reply and concern.
This is a great platform to use.
Best of luck for your future endeavor.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1736
    • View Profile
    • 3DNA homepage
Re: Adding missing residue in PDB file of RNA
« Reply #3 on: February 08, 2017, 11:38:03 am »
Hi,

Thanks for your kind words. If possible, please share you experience in solving the problem you posted. 3DNA may be useful at certain stage(s) of the process, if you fail to find a fully automated way that perfectly does the trick.

Best regards,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University