Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Author Topic: single strand DNA in hairpin conformation  (Read 92307 times)

Offline alliki

  • with-posts
  • *
  • Posts: 3
    • View Profile
single strand DNA in hairpin conformation
« on: February 13, 2015, 05:11:36 am »
Dear 3DNA users,

I am new to 3DNA package.
I would like to prepare a single strand DNA in a hairpin conformation. Could anyone suggest me how could I do it?
Thank you for any suggestions,

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: single strand DNA in hairpin conformation
« Reply #1 on: February 13, 2015, 12:42:41 pm »
Welcome to 3DNA!

Quote
I would like to prepare a single strand DNA in a hairpin conformation. Could anyone suggest me how could I do it?
3DNA does not have a direct facility of generating a single-stranded DNA in hairpin loop. There are so many possible variations. If you have base sequence and corresponding step parameters, you can use "rebuild" to generate any single-stranded or duplex DNA structure as specified. Alternatively, you could use "mutate_bases" to change bases in a known structure. Also, you may find the NAB program from the David Case lab better fits your needs.

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline alliki

  • with-posts
  • *
  • Posts: 3
    • View Profile
Re: single strand DNA in hairpin conformation
« Reply #2 on: February 17, 2015, 09:15:19 am »
I have already asked amber users but D.Case recommended me to look for other software. I have a base sequence and I know how the hairpin should look like (steams, Internal loops, hairpin loop and single stranded fragment).
Could you write me how should I use the "rebuild" script? I was not able to find examples in the 3DNA manual. Thank you in advance.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: single strand DNA in hairpin conformation
« Reply #3 on: February 17, 2015, 10:28:53 am »
You can find basic usage of the 3DNA 'rebuild' program by 'rebuild -h', and refer to the 2008 Nature Protocols paper for illustrated examples. Other relevant programs within 3DNA includes 'analyze', 'mutate_bases' and 'std_base'. The "Users' contributions" section contains further examples that may be helpful.

Overall, 3DNA is not an 'easy to use' tool for your task and it may not fulfill all your requirements. That's why I asked you to check elsewhere including NAB in AMBER. You may also find the various state-of-the-art tools in RNAPuzzle (http://ahsoka.u-strasbg.fr/rnapuzzles/) useful. But if you cannot find a satisfcatory solution elsewhere and want to give 3DNA a try, please be specific with each step and I will try to provide concrete help along the way.

Xiang-Jun
« Last Edit: February 17, 2015, 11:57:23 am by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline alliki

  • with-posts
  • *
  • Posts: 3
    • View Profile
Re: single strand DNA in hairpin conformation
« Reply #4 on: February 18, 2015, 11:40:43 am »
Dear Xiang-Jun,

Thank you for your kind reply. My sequence for ssDNA is: . 5' GCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGG'3  I attached you the hairpin that I would like to get out of this sequence.  How should I start here? From rebuild command, or should I try to define steams? Do you have maybe any input files that I could follow?
The article that you suggested me to go throw I will have in two days.

Thank you for your help
Urszula Uciechowska

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: single strand DNA in hairpin conformation
« Reply #5 on: February 18, 2015, 01:02:40 pm »
Thanks for providing the ssDNA sequence and its secondary structure diagram. You said you "would like to get [the hairpin] out of this sequence". Are you aiming to get three-dimensional coordinates with the corresponding secondary structure? What's the purpose of the 3D coordinates? Do you have any restraints on the 3D structure? Or any 3D structure at all will do? Note that there is no one-to-one correspondance between 2D to 3D structures. For example, the loop regions can have different conformations, and the (helical) stems can be at least in A- or B-form.

Did you know Assemble2 (http://www.bioinformatics.org/assemble/index.html) which "allows you to design your RNA 2D structure interactively and to create and assemble the corresponding RNA 3D modules directly in UCSF Chimera"? Assemble2 may be a better tool to fit your needs (even though it is for 'RNA'), at least to begin with. 3DNA can be put into good use once you have an approximate 3D structure generated with Assemble2. Clearly, this is not a 'magic' automated process. Users must know want they want to achieve, and be careful with each step.

Xiang-Jun
« Last Edit: February 18, 2015, 01:05:24 pm by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University