Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Author Topic: building a ssDNA  (Read 123962 times)

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
building a ssDNA
« on: March 07, 2011, 10:29:41 pm »
Dear All,

I just started using 3DNA. I want to build a pdb file for single strand DNA that I can use in gromacs to simulate interaction between DNA and CNT. I skimmed through the manual, but don't understand how to get started. Could anyone please highlight what should I look into to create this pdb file?

Thanks,
Majid

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: building a ssDNA
« Reply #1 on: March 08, 2011, 12:05:59 am »
Hi Majid,

You may want to use '[mono:4xhr4aus]fiber[/mono:4xhr4aus]' to generate a duplex DNA of specific sequence, and then extract only chain A either manually, or with the simple Perl script '[mono:4xhr4aus]pdb_frag[/mono:4xhr4aus]'. Here is an example, [red:4xhr4aus]red[/red:4xhr4aus] text means user input:
[pre:4xhr4aus][red:4xhr4aus]fiber my_seq.pdb[/red:4xhr4aus]
Structure #4; Twist: 36.0 (degrees); Rise: 3.375 (Angstrom)

Input your base sequence with only A,C,G & T:
1. From a data file (complete sequence)
2. From keyboard (enter only the repeating sequence)
Your choice (1 or 2, Dft: 2): [red:4xhr4aus]ENTER[/red:4xhr4aus]    # to use the default option

Repeating unit (Dft: A): [red:4xhr4aus]ACGGGTTTTAAAAACCTTTA[/red:4xhr4aus]    # type your sequence
Repeating unit: ACGGGTTTTAAAAACCTTTA
Number of repeats (Dft: 10):  [red:4xhr4aus]1[/red:4xhr4aus]  # just repeat once of the sequence
# Now use RasMol or whatever your preferred viewer to display the duplex structure.

[red:4xhr4aus]pdb_frag A 1:20 my_seq.pdb my_ssDNA.pdb[/red:4xhr4aus]
# my_ssDNA.pdb may be what you want. Again, display it in RasMol.[/pre:4xhr4aus]
Of course, the above procedure could look cryptic and scary for GUI-driven point-and-click users. However, once you know what you are doing, it is easy to write a script to automate the process to ensure quick and reproducible computational 'experiments'.

Just play around to get more familiar with 3DNA. A good starting point could be to reproduce the reported results in the 2008 3DNA Nature Protocols paper to have a feeling of 3DNA has to offer. Do not hesitate to ask if you have any questions.

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #2 on: March 08, 2011, 07:00:18 pm »
Okay, thanks Xiangjun! I'll try that.

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #3 on: March 17, 2011, 06:17:38 pm »
Hi Xiangjun,

I tried out the procedure you mentioned to create ssDNA.pdb. But in the last step (after entering number of steps = 1), I get following error "Number of repeats (Dft: 10): 1
open_file <my_seq.pdb> failed: Permission denied
". I used to get such errors in gromacs when it wasn't installed in my home folder, and I needed root permission to write. But, 3DNA is located in my home folder, so I am not sure why am I getting this. Could you help me with this?

Thanks,
Majid

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #4 on: March 17, 2011, 06:48:42 pm »
Ok, this problem is solved. I set my environment variables but didn't change directory to X3DNA. When I issued the commands in that directory, it worked. But I have one more question. I am unable to find pdb_frag command in X3DNA/bin directory. I search it in X3DNA as well but couldn't find it. And its not mentioned in 3DNA manual as well. Do I have to get it separately?

Thanks,
Majid

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: building a ssDNA
« Reply #5 on: March 17, 2011, 10:36:28 pm »
Hi Majid,

Which version of 3DNA are you using? What '[mono:rzqs4j2j][red:rzqs4j2j]find_pair -h[/red:rzqs4j2j][/mono:rzqs4j2j]' gives you? Do you see the text "3DNA v2.0 [June 8, 2008]" at the bottom? If not, you are using a previous version of 3DNA (maybe v1.5), and it is high time to upgrade to v2.0.

The very simple Perl script '[mono:rzqs4j2j]pdb_frag[/mono:rzqs4j2j]' is included as part of 3DNA v2.0, in the [mono:rzqs4j2j]$X3DNA/bin[/mono:rzqs4j2j] directory. It is not documented because I do not think it worths the effort  :wink: -- simply look at the code will reveal everything. Given an opportunity, I will completely refine/extend the utility and then document it, with plenty examples  :) .

Please note the example I showed you is just an illustration of how single strand DNA model can be built using 3DNA, from the (limited) information you provided. There are a couple of other possibilities to explore as well. For those who really want to get the most of what 3DNA has to offer, the most effective way is to read carefully the 2008 3DNA Nature Protocols paper, and try to reproduce and understand each of the recipes/protocols -- I will be happy to address any issues users may encounter in repeating the results reported in this article.

HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #6 on: April 08, 2011, 01:27:35 pm »
Okay, thanks Xiangjun! I have an older version of 3DNA, but I am going to upgrade it to  2.0.

Majid

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #7 on: April 08, 2011, 02:37:35 pm »
Hi Xiangjun,

With 3DNA v2.0 I could create the single strand dna. But when I try to create the toplogy file (.top), it gives me following error: Fatal error:
Could only find a forcefield type for 119 out of 287 atoms

I am using the oplsaa forcefield, and I suspect it is because  atomname2type.n2t file doesn't contain all the possible bonds in it. Copy of my .n2t file is attached below. Could you guide me how to add all these possible bonds in my .n2t file?

Thanks,
Majid


atomname2type.n2t file

C    opls_157    -0.18   12.011   4    H 0.108   H 0.108   H 0.108   C 0.150
C    opls_158    -0.12  12.011   4    H 0.108   H 0.108   C 0.150   C 0.150
C    opls_157    0.145  12.011   4    H 0.108   O 0.141   H 0.108   C 0.150
C    opls_157    0.145  12.011   4    H 0.108   H 0.108   O 0.108   C 0.150
C    opls_158    0.205  12.011   4    H 0.108   C 0.150   O 0.140   C 0.150
C    opls_158    -0.06  12.011   4    H 0.108   C 0.150   C 0.150   C 0.150  
C    opls_145    -0.12  12.011   3    C 0.150   C 0.150   H 0.108
C    opls_145    -0.12  12.011    3    C 0.133   C 0.150   O 0.140
C    opls_235    0.5    12.011    3    C 0.133   N 0.140   O 0.140
C    opls_235    0.5    12.011    3    C 0.133   N 0.132   C 0.150
C    opls_235    0.5    12.011    3    C 0.133   N 0.132   H 0.108
O    opls_236    -0.5   15.9994 1    C 0.123
N    opls_238    -0.5   14.0067 3    H 0.108   C 0.140   C 0.150
N    opls_238    -0.5   14.0067 3    H 0.108   C 0.132   N 0.123
N    opls_238    0      14.0067 2    C 0.140   N 0.123
H    opls_140    0.06    1.008    1    C 0.108
H    opls_155    0.418   1.008   1    O 0.095
H    opls_241    0.30    1.008   1    N 0.095
O    opls_154    -0.683 15.9994 2    C 0.140   H 0.095
P    opls_393    1     30.97376 4    O 0.180   O 0.180   O 0.180   O 0.180
O    opls_395    -1     15.9994   2    P 0.180   H 0.095
O    opls_394    -1     15.9994 1    P 0.180
N    opls_237    0      14.0067 4    C 0.140   C 0.140   C 0.140   C 0.140
C    opls_240    0      12.011  3    C 0.142   C 0.142   C 0.142
C    opls_239    0      12.011  2    C 0.142   C 0.142

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: building a ssDNA
« Reply #8 on: April 08, 2011, 07:39:46 pm »
Hi Majid,

Glad to see that with 3DNA v2.0, you can now create single stranded DNA. Regarding the topology file and the error message you referred to, they clearly have nothing to do with 3DNA; I sense they may be related to the Gromacs molecular dynamics package you referred to in your first message of the thread.

HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #9 on: April 09, 2011, 01:14:13 pm »
Yes, I suspect so too.

Thanks for your help,
Majid

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #10 on: April 09, 2011, 09:05:13 pm »
Hi Xiangjun,

I am creating .pdb file for a single strand dna by following the method you suggested. But this dna doesn't have asymmetric ends, while I need to cap it with 5' and 3'. Can you guide me how do make the ends 5', and 3'?

Thanks,
Majid

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1738
    • View Profile
    • 3DNA homepage
Re: building a ssDNA
« Reply #11 on: April 10, 2011, 12:31:42 pm »
Quote from: "kista"
But this dna doesn't have asymmetric ends, while I need to cap it with 5' and 3'. Can you guide me how do make the ends 5', and 3'?
What do you mean "DNA capped with 5' and 3' ends"? Please be specific, illustrated with examples.

Do you see such caps with DNA structures downloaded from PDB/NDB?

Again, I sense this concept may be more related to the requirements of your MD simulations than to 3DNA.

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline kista

  • with-posts
  • *
  • Posts: 9
    • View Profile
Re: building a ssDNA
« Reply #12 on: April 18, 2011, 11:32:46 am »
It was just a requirement of the project I am doing. I wanted the ends of DNA to be different from the body. But this problem is solved. I manually changed the residues at both ends, in pdb file.

Thanks,
Majid

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University