Recent Posts

41

RNA structures (DSSR) / plotting the helical axis along curved helices

« Last post by Di_Liu on October 24, 2024, 07:45:43 pm »

Hi Xiang-Jun,

I tried to extract the coordinates of the origin points of the base-pair reference frame from the json file. It appears working for DNA structures; but for RNA, the points form a spiral around the helical axis (see attached image), as we would expect due to the differences of how the axis passes through the base-pairs in B- and A-form helices.

Thanks,

Di

42

Site announcements / X3DNA-DSSR is funded and DSSR Basic is free for academic users

« Last post by xiangjun on September 25, 2024, 10:31:18 am »

Dear 3DNA/DSSR users,

It gives me great pleasure to announce that the 3DNA/DSSR project is now funded by the NIH R24GM153869 grant, "X3DNA-DSSR: a resource for structural bioinformatics of nucleic acids". I am deeply grateful for the opportunity to continue working on a project that has basically defined who I am. It was a tough time during the funding gap over the past few years. Nevertheless, I have experienced and learned a lot, and witnessed miracles enabled by enthusiastic users.

Since late 2020 when I lost my R01 grant, DSSR has been licensed by the Columbia Technology Ventures (CTV). I appreciate the numerous users (including big pharma) who purchased a DSSR Pro License or a DSSR Basic paid License. Thanks to the NIH R24GM153869 grant, we are pleased to provide DSSR Basic free of charge to the academic community. Academic Users may submit a license request for DSSR Basic or DSSR Pro by clicking "Express Licensing" on the CTV landing page. Commercial users may inquire about pricing and licensing terms by emailing techtransfer@columbia.edu, copying xiangjun@x3dna.org.

The current version of DSSR is v2.4.5-2024sep24 which contains miscellaneous bug fixes (e.g., chain id with > 4 chars) and minor improvements. This release synchronizes with the new R24 funding, which will bring the project to the next stage. All existing users are encouraged to upgrade their installation.

Lots of exciting things will happen for the project. The first important thing is to make DSSR freely accessible to the academic community. I'm now starting to monitor the Forum closely and answer users questions promptly.

I am committed to making DSSR a brand that stands for quality and value. By virtue of its unmatched functionality, usability, and support, DSSR saves users a substantial amount of time and effort when compared to other options. My track record throughout the years has unambiguously demonstrated my dedication to this solid software product.

Xiang-Jun

DSSR Basic contains all features described in the three DSSR-related papers, and include the originally separate SNAP program (still unpublished) for analyzing DNA/RNA-protein complexes. The Pro version integrates the classic 3DNA functionality, plus advanced modeling routines, with email/Zoom/phone support.

43

RNA structures (DSSR) / Re: How the length of the sequence depends on _pdbx_unobs_or_zero_occ_atoms ???

« Last post by sk on September 06, 2024, 10:23:46 am »

Thank you, Xiang-Jun.

44

RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?

« Last post by xiangjun on September 05, 2024, 11:10:22 pm »

Pay attention to the following section:

# x3dna-dssr -i=8SH5.pdb

  stem#3[#2, #3]* bps=2 parallel
      strand-1 5'-GG-3'
       bp-type    ||
      strand-2 5'-CC-3'
      helix-form  .
   1 R.G19          R.C49          G-C WC           19-XIX    cWW  cW-W
   2 R.G20          R.C50          G-C WC           19-XIX    cWW  cW-W

These two WC pairs form a parallel mini-duplex. Both pairs (not just G19-C49 but also G20-C50) are excluded from the DBN notation.

Best regards,

Xiang-Jun

45

RNA structures (DSSR) / Re: How the length of the sequence depends on _pdbx_unobs_or_zero_occ_atoms ???

« Last post by xiangjun on September 05, 2024, 10:58:42 pm »

Hi,

DSSR is based on 3D structures of DNA/RNA, deriving features of base-pairing and stacking interactions. It also takes abasic sites into consideration in later releases, requiring only P or at least 5 out of the 6 main-chain backbone atoms (P, O5', C5', C4', C3', and O3'). In PDB entry 4AL5, nucleotide C4 has only one backbone atom (O3'), and C21 has 4 backbone atoms (P, O1P, O2P, and O5') as shown below.

ATOM   2826 O "O3'"  . C   B 2 3   ? 14.682 -18.630 19.841  1.00 152.11 ? 4    C   B "O3'"  1
......
ATOM   3343 P P      . C   B 2 20  ? 2.515  -3.243  14.608  1.00 43.27  ? 21   C   B P      1
ATOM   3344 O OP1    . C   B 2 20  ? 1.257  -3.732  14.022  1.00 60.70  ? 21   C   B OP1    1
ATOM   3345 O OP2    . C   B 2 20  ? 2.599  -1.863  15.133  1.00 37.31  ? 21   C   B OP2    1
ATOM   3346 O "O5'"  . C   B 2 20  ? 2.975  -4.175  15.812  1.00 40.82  ? 21   C   B "O5'"  1

So in previous DSSR versions, both nucleotides are ignored.

Following your question, I've revised DSSR to v2.4.4-2024sep06 which can recognize these two nucleotides. See below:

# x3dna-dssr -i=4AL5.cif
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4AL5 nts=18 [whole]
CACUGCCGUAUAGGCAGC
..(((((.....))))).
-.AAAA..A...AAAA--

****************************************************************************
Summary of structural features of 18 nucleotides
  Note: the first five columns are: (1) serial number, (2) one-letter
    shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base
    ring atoms fitted against those in a standard base reference
    frame. The sixth (last) column contains a comma-separated list of
    features whose meanings are mostly self-explanatory, except for:
      turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees
      break: no backbone linkage between O3'(i-1) and P(i)
   1  C . B.C4      ---    non-stack,ss-non-loop
   2  A . B.A5      0.013  anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart
   3  C ( B.C6      0.007  anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart
   4  U ( B.U7      0.009  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate
   5  G ( B.G8      0.015  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate
   6  C ( B.C9      0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate
   7  C ( B.C10     0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate
   8  G . B.G11     0.043  u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate
   9  U . B.U12     0.019  turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop
  10  A . B.A13     0.022  u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate
  11  U . B.U14     0.006  turn,u-turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart
  12  A . B.A15     0.007  anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart
  13  G ) B.G16     0.017  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop
  14  G ) B.G17     0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  15  C ) B.C18     0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  16  A ) B.A19     0.014  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem
  17  G ) B.G20     0.018  anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end
  18  C . B.C21     ---    non-stack,ss-non-loop,phosphate

Best regards,

Xiang-Jun

46

RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?

« Last post by sk on September 04, 2024, 04:26:40 pm »

Another question in the same topic.

If I run "x3dna-dssr  --more -i=pdb-data/8SH5.cif" it says

Code: [Select]

...
  17 R.G19          R.C49          G-C WC          19-XIX    cWW  cW-W
       [-155.1(anti) ~C3'-endo lambda=50.2] [-106.9(anti) ~C2'-endo lambda=53.7]
       d(C1'-C1')=10.82 d(N1-N9)=9.00 d(C6-C8)=9.90 tor(C1'-N1-N9-C1')=-11.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]"
       interBase-angle=8  Simple-bpParams: Shear=-0.21 Stretch=-0.13 Buckle=-2.1 Propeller=-7.6
...

But in dbn, there is no parentheses on these positions (19 and 49). Why? Maybe because of a non-canonical pair have G19-C51 or G19-G22  ?
Do you discard a canonical pair (x,y) if there is a non-canonical one (x,z) with z < y ?

47

RNA structures (DSSR) / How the length of the sequence depends on _pdbx_unobs_or_zero_occ_atoms ???

« Last post by sk on September 04, 2024, 08:45:08 am »

Hello,

I'm trying to understand why dssr says that 4AL5 has 16 nucleotides.

Cif file contains 20 nucleotides UUCACUGCCGUAUAGGCAGC as _entity_poly.pdbx_seq_one_letter_code,
dssr gives only 16 ACUGCCGUAUAGGCAG.

The sequence is explained as

Code: [Select]

loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero

B 2 1   U   1   2   ?   ?   ?   B . n
B 2 2   U   2   3   ?   ?   ?   B . n
B 2 3   C   3   4   4   C   C   B . n
B 2 4   A   4   5   5   A   A   B . n
B 2 5   C   5   6   6   C   C   B . n
B 2 6   U   6   7   7   U   U   B . n
B 2 7   G   7   8   8   G   G   B . n
B 2 8   C   8   9   9   C   C   B . n
B 2 9   C   9   10  10  C   C   B . n
B 2 10  G   10  11  11  G   G   B . n
B 2 11  U   11  12  12  U   U   B . n
B 2 12  A   12  13  13  A   A   B . n
B 2 13  U   13  14  14  U   U   B . n
B 2 14  A   14  15  15  A   A   B . n
B 2 15  G   15  16  16  G   G   B . n
B 2 16  G   16  17  17  G   G   B . n
B 2 17  C   17  18  18  C   C   B . n
B 2 18  A   18  19  19  A   A   B . n
B 2 19  G   19  20  20  G   G   B . n
B 2 20  C   20  21  21  C   C   B . n

If I understand correctly you removed first to lines because _pdbx_poly_seq_scheme.pdb_mon_id  = ? (consequence of _pdbx_unobs_or_zero_occ_residues ? )

But why you should remove C21 and C4 ?
Looks like it has something to do with _pdbx_unobs_or_zero_occ_atoms.

Could you please clarify the situation ?
Thanks in advance.

48

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by xiangjun on August 08, 2024, 07:33:33 pm »

Hi Parivash,

DSSR (http://forum.x3dna.org/site-announcements/no-more-grant-funding-for-3dnadssr/) can find all base pairs and tertiary stacking interactions, among numerous other features. Using your RNA.pdb as an example, run the following commands:

Code: [Select]

x3dna-dssr -i=RNA.pdb -o=RNA.out
x3dna-dssr -i=RNA.pdb --non-pair | grep 'stacking:' | grep -v connected > long-stacks.txt
The output files RNA.out and long-stacks.txt are attached for your reference. The RNA.out contains a port of stacking interactions as listed below:

Code: [Select]

****************************************************************************
List of 63 base stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
   1 nts=2 AG A.A563,A.G567
   2 nts=2 GA A.G570,A.A873
   3 nts=2 AA A.A573,A.A574
   4 nts=2 GG A.G587,A.G755
   5 nts=2 GU A.G597,A.U598
   6 nts=2 GC A.G617,A.C618
   7 nts=2 AG A.A632,A.G633
   8 nts=2 AC A.A642,A.C643
   9 nts=2 GC A.G644,A.C645
  10 nts=2 GG A.G657,A.G658
  11 nts=2 GG A.G688,A.G700
  12 nts=2 CG A.C701,A.G703
  13 nts=2 GG A.G727,A.G731
  14 nts=2 CC A.C747,A.C748
  15 nts=2 AG A.A777,A.G778
  16 nts=2 UC A.U804,A.C805
  17 nts=2 CA A.C817,A.A819
  18 nts=2 GU A.G818,A.U820
  19 nts=2 UU A.U827,A.U870
  20 nts=2 GC A.G838,A.C840
  21 nts=2 CU A.C862,A.U863
  22 nts=2 CG A.C866,A.G867
  23 nts=2 AG A.A872,A.G874
  24 nts=2 CC A.C879,A.C880
  25 nts=2 GG A.G898,A.G902
  26 nts=2 CA A.C912,A.A913
  27 nts=3 CUC A.C562,A.U884,A.C883
  28 nts=3 CUG A.C564,A.U565,A.G566
  29 nts=3 AAA A.A572,A.A864,A.A865
  30 nts=3 GAU A.G577,A.A816,A.U813
  31 nts=3 GAG A.G662,A.A663,A.G664
  32 nts=3 AAG A.A728,A.A729,A.G730
  33 nts=3 CAA A.C732,A.A665,A.A733
  34 nts=3 GGG A.G774,A.G775,A.G776
  35 nts=3 GGG A.G821,A.G575,A.G881
  36 nts=3 GGU A.G890,A.G906,A.U905
  37 nts=3 CAA A.C899,A.A900,A.A901
  38 nts=4 UGGU A.U580,A.G581,A.G758,A.U757
  39 nts=4 GAGA A.G588,A.A753,A.G654,A.A655
  40 nts=4 GGUA A.G594,A.G595,A.U641,A.A640
  41 nts=4 CAAC A.C620,A.A621,A.A622,A.C623
  42 nts=4 CUGU A.C651,A.U652,A.G752,A.U751
  43 nts=4 GGGU A.G666,A.G741,A.G742,A.U743
  44 nts=4 GAGU A.G683,A.A684,A.G685,A.U686
  45 nts=4 CGGU A.C689,A.G690,A.G691,A.U692
  46 nts=4 CAGG A.C779,A.A780,A.G800,A.G799
  47 nts=4 GAUU A.G786,A.A787,A.U788,A.U789
  48 nts=4 CGGC A.C857,A.G858,A.G869,A.C868
  49 nts=4 GGAU A.G887,A.G888,A.A889,A.U891
  50 nts=5 GAUGG A.G584,A.A583,A.U582,A.G760,A.G761
  51 nts=5 AAUAC A.A687,A.A704,A.U705,A.A706,A.C707
  52 nts=5 CGCCC A.C764,A.G765,A.C812,A.C811,A.C810
  53 nts=5 GAAAA A.G769,A.A768,A.A767,A.A766,A.A814
  54 nts=5 CAUAG A.C783,A.A782,A.U801,A.A802,A.G803
  55 nts=5 GAAAG A.G829,A.A828,A.A859,A.A860,A.G861
  56 nts=6 UGGGGG A.U605,A.G606,A.G631,A.G630,A.G629,A.G628
  57 nts=6 AAAGAC A.A607,A.A608,A.A609,A.G610,A.A611,A.C612
  58 nts=6 GAAAUG A.G693,A.A694,A.A695,A.A696,A.U697,A.G698
  59 nts=6 AGGAAC A.A712,A.G713,A.G714,A.A715,A.A716,A.C717
  60 nts=6 AGAACC A.A790,A.G791,A.A792,A.A794,A.C795,A.C796
  61 nts=7 UUAAGGG A.U678,A.U677,A.A676,A.A675,A.G674,A.G673,A.G734
  62 nts=7 GCCGAGG A.G718,A.C719,A.C720,A.G721,A.A722,A.G724,A.G725
  63 nts=7 GCAAAAC A.G894,A.C893,A.A892,A.A907,A.A908,A.A909,A.C910

Best regards,

Xiang-Jun

49

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by pfeyzi on July 30, 2024, 03:59:27 pm »

Thanks

50

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by pfeyzi on July 29, 2024, 02:22:23 pm »

Dear Dr. Lu,

Can we find list of tertiary stacks from pdb by using x3DNA? like Example_stacks.dat for RNA.pdb file that I attached.

As I run this command
```
find_pair RNA.pdb bpfile.out
analyze bpfile.out 
```
it generate bunch of files like hstacking.pdb
but I don't know how to get that tertiary stacks list!