Messages

1

General discussions (Q&As) / Re: single strand DNA in hairpin conformation

« on: February 18, 2015, 11:40:43 am »

Dear Xiang-Jun,

Thank you for your kind reply. My sequence for ssDNA is: . 5' GCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTTAGCGGTGG'3  I attached you the hairpin that I would like to get out of this sequence.  How should I start here? From rebuild command, or should I try to define steams? Do you have maybe any input files that I could follow?
The article that you suggested me to go throw I will have in two days.

Thank you for your help
Urszula Uciechowska

2

General discussions (Q&As) / Re: single strand DNA in hairpin conformation

« on: February 17, 2015, 09:15:19 am »

I have already asked amber users but D.Case recommended me to look for other software. I have a base sequence and I know how the hairpin should look like (steams, Internal loops, hairpin loop and single stranded fragment).
Could you write me how should I use the "rebuild" script? I was not able to find examples in the 3DNA manual. Thank you in advance.

3

General discussions (Q&As) / single strand DNA in hairpin conformation

« on: February 13, 2015, 05:11:36 am »

Dear 3DNA users,

I am new to 3DNA package.
I would like to prepare a single strand DNA in a hairpin conformation. Could anyone suggest me how could I do it?
Thank you for any suggestions,