Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers

Author Topic: changing some of the RNA sequence of an chain to DNA  (Read 7992 times)

Offline Sruthi0412

  • with-posts
  • *
  • Posts: 5
    • View Profile
changing some of the RNA sequence of an chain to DNA
« on: September 27, 2020, 03:28:47 pm »
I am beginner in x3dna and wanted to know how to change a few of the RNA sequences in my RNA into DNA sequences. There are 20 nt in my chain and I want the bases 4-8 to be DNA. Could you give some guidelines regarding changing this

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1640
    • View Profile
    • 3DNA homepage
Re: changing some of the RNA sequence of an chain to DNA
« Reply #1 on: September 27, 2020, 05:18:15 pm »
Please be specific: provide an example so that others can reproduce.

As a reminder, here is a list of items in the "Registration Agreement":

Quote
When posting on the Forum, please abide by the following rules:

0.  Do your homework; read the FAQ and browse the Forum.
1.  Ask your questions on the *public* 3DNA Forum instead of sending
        xiangjun emails or personal messages. Additionally, please note
        that your posts on the 3DNA Forum are in the *public domain*.
2.  Be specific with your questions; provide a minimal, reproducible
        example if possible; use attachments where appropriate.
3.  Respond to requests for clarification. Failure to do so may result in
        delay or no answer to your questions.
4.  Summarize the solution to your problem from a user's perspective
        by providing step-by-step details, for the community's benefit.
5+ Contribute back to the 3DNA project:
        o Report bugs — including typos
        o Make constructive suggestions — anything that can make 3DNA better
        o Answer other users' questions
        o Share your use cases in the "Users' contributions" section

Xiang-Jun

Offline Sruthi0412

  • with-posts
  • *
  • Posts: 5
    • View Profile
Re: changing some of the RNA sequence of an chain to DNA
« Reply #2 on: September 27, 2020, 06:04:55 pm »
Sorry for not being clear in my first query.
 I have a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' .
I want to change the CAUA region to DNA bases. Basically, I want the sequence to be changed as DC DA DT DA (Nucleotides 4-8) , while all the other nucleotides are the same RNA sequences. I wanted to know if it is possible to do so in x3dna. I want to run some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand. I am attaching the RNA pdb here.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1640
    • View Profile
    • 3DNA homepage
Re: changing some of the RNA sequence of an chain to DNA
« Reply #3 on: September 28, 2020, 11:10:37 am »
Hi,

Thanks for your followup -- it helps clarify previous ambiguities.

In 3DNA, you could perform base mutations without changing backbone geometry using the mutate_bases program. As an example, to mutate U6 to DT, you can do the following:

Code: [Select]
mutate_bases 'chain=A snum=6 m=DT' rna2.pdb mutated-U6DT.pdb
You may mutate all four bases simultaneously. Check mutate_bases -h. You then need to remove O2' atoms manually.

DSSR 2.0 has a much powerful modeling module that supersedes mutate_bases, with many more features.

HTH,

Xiang-Jun

« Last Edit: September 28, 2020, 11:14:35 am by xiangjun »

 

Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.