Recent Posts

81

RNA structures (DSSR) / How the length of the sequence depends on _pdbx_unobs_or_zero_occ_atoms ???

« Last post by sk on September 04, 2024, 08:45:08 am »

Hello,

I'm trying to understand why dssr says that 4AL5 has 16 nucleotides.

Cif file contains 20 nucleotides UUCACUGCCGUAUAGGCAGC as _entity_poly.pdbx_seq_one_letter_code,
dssr gives only 16 ACUGCCGUAUAGGCAG.

The sequence is explained as

Code: [Select]

loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero

B 2 1   U   1   2   ?   ?   ?   B . n
B 2 2   U   2   3   ?   ?   ?   B . n
B 2 3   C   3   4   4   C   C   B . n
B 2 4   A   4   5   5   A   A   B . n
B 2 5   C   5   6   6   C   C   B . n
B 2 6   U   6   7   7   U   U   B . n
B 2 7   G   7   8   8   G   G   B . n
B 2 8   C   8   9   9   C   C   B . n
B 2 9   C   9   10  10  C   C   B . n
B 2 10  G   10  11  11  G   G   B . n
B 2 11  U   11  12  12  U   U   B . n
B 2 12  A   12  13  13  A   A   B . n
B 2 13  U   13  14  14  U   U   B . n
B 2 14  A   14  15  15  A   A   B . n
B 2 15  G   15  16  16  G   G   B . n
B 2 16  G   16  17  17  G   G   B . n
B 2 17  C   17  18  18  C   C   B . n
B 2 18  A   18  19  19  A   A   B . n
B 2 19  G   19  20  20  G   G   B . n
B 2 20  C   20  21  21  C   C   B . n

If I understand correctly you removed first to lines because _pdbx_poly_seq_scheme.pdb_mon_id  = ? (consequence of _pdbx_unobs_or_zero_occ_residues ? )

But why you should remove C21 and C4 ?
Looks like it has something to do with _pdbx_unobs_or_zero_occ_atoms.

Could you please clarify the situation ?
Thanks in advance.

82

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by xiangjun on August 08, 2024, 07:33:33 pm »

Hi Parivash,

DSSR (http://forum.x3dna.org/site-announcements/no-more-grant-funding-for-3dnadssr/) can find all base pairs and tertiary stacking interactions, among numerous other features. Using your RNA.pdb as an example, run the following commands:

Code: [Select]

x3dna-dssr -i=RNA.pdb -o=RNA.out
x3dna-dssr -i=RNA.pdb --non-pair | grep 'stacking:' | grep -v connected > long-stacks.txt
The output files RNA.out and long-stacks.txt are attached for your reference. The RNA.out contains a port of stacking interactions as listed below:

Code: [Select]

****************************************************************************
List of 63 base stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
   1 nts=2 AG A.A563,A.G567
   2 nts=2 GA A.G570,A.A873
   3 nts=2 AA A.A573,A.A574
   4 nts=2 GG A.G587,A.G755
   5 nts=2 GU A.G597,A.U598
   6 nts=2 GC A.G617,A.C618
   7 nts=2 AG A.A632,A.G633
   8 nts=2 AC A.A642,A.C643
   9 nts=2 GC A.G644,A.C645
  10 nts=2 GG A.G657,A.G658
  11 nts=2 GG A.G688,A.G700
  12 nts=2 CG A.C701,A.G703
  13 nts=2 GG A.G727,A.G731
  14 nts=2 CC A.C747,A.C748
  15 nts=2 AG A.A777,A.G778
  16 nts=2 UC A.U804,A.C805
  17 nts=2 CA A.C817,A.A819
  18 nts=2 GU A.G818,A.U820
  19 nts=2 UU A.U827,A.U870
  20 nts=2 GC A.G838,A.C840
  21 nts=2 CU A.C862,A.U863
  22 nts=2 CG A.C866,A.G867
  23 nts=2 AG A.A872,A.G874
  24 nts=2 CC A.C879,A.C880
  25 nts=2 GG A.G898,A.G902
  26 nts=2 CA A.C912,A.A913
  27 nts=3 CUC A.C562,A.U884,A.C883
  28 nts=3 CUG A.C564,A.U565,A.G566
  29 nts=3 AAA A.A572,A.A864,A.A865
  30 nts=3 GAU A.G577,A.A816,A.U813
  31 nts=3 GAG A.G662,A.A663,A.G664
  32 nts=3 AAG A.A728,A.A729,A.G730
  33 nts=3 CAA A.C732,A.A665,A.A733
  34 nts=3 GGG A.G774,A.G775,A.G776
  35 nts=3 GGG A.G821,A.G575,A.G881
  36 nts=3 GGU A.G890,A.G906,A.U905
  37 nts=3 CAA A.C899,A.A900,A.A901
  38 nts=4 UGGU A.U580,A.G581,A.G758,A.U757
  39 nts=4 GAGA A.G588,A.A753,A.G654,A.A655
  40 nts=4 GGUA A.G594,A.G595,A.U641,A.A640
  41 nts=4 CAAC A.C620,A.A621,A.A622,A.C623
  42 nts=4 CUGU A.C651,A.U652,A.G752,A.U751
  43 nts=4 GGGU A.G666,A.G741,A.G742,A.U743
  44 nts=4 GAGU A.G683,A.A684,A.G685,A.U686
  45 nts=4 CGGU A.C689,A.G690,A.G691,A.U692
  46 nts=4 CAGG A.C779,A.A780,A.G800,A.G799
  47 nts=4 GAUU A.G786,A.A787,A.U788,A.U789
  48 nts=4 CGGC A.C857,A.G858,A.G869,A.C868
  49 nts=4 GGAU A.G887,A.G888,A.A889,A.U891
  50 nts=5 GAUGG A.G584,A.A583,A.U582,A.G760,A.G761
  51 nts=5 AAUAC A.A687,A.A704,A.U705,A.A706,A.C707
  52 nts=5 CGCCC A.C764,A.G765,A.C812,A.C811,A.C810
  53 nts=5 GAAAA A.G769,A.A768,A.A767,A.A766,A.A814
  54 nts=5 CAUAG A.C783,A.A782,A.U801,A.A802,A.G803
  55 nts=5 GAAAG A.G829,A.A828,A.A859,A.A860,A.G861
  56 nts=6 UGGGGG A.U605,A.G606,A.G631,A.G630,A.G629,A.G628
  57 nts=6 AAAGAC A.A607,A.A608,A.A609,A.G610,A.A611,A.C612
  58 nts=6 GAAAUG A.G693,A.A694,A.A695,A.A696,A.U697,A.G698
  59 nts=6 AGGAAC A.A712,A.G713,A.G714,A.A715,A.A716,A.C717
  60 nts=6 AGAACC A.A790,A.G791,A.A792,A.A794,A.C795,A.C796
  61 nts=7 UUAAGGG A.U678,A.U677,A.A676,A.A675,A.G674,A.G673,A.G734
  62 nts=7 GCCGAGG A.G718,A.C719,A.C720,A.G721,A.A722,A.G724,A.G725
  63 nts=7 GCAAAAC A.G894,A.C893,A.A892,A.A907,A.A908,A.A909,A.C910

Best regards,

Xiang-Jun

83

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by pfeyzi on July 30, 2024, 03:59:27 pm »

Thanks

84

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by pfeyzi on July 29, 2024, 02:22:23 pm »

Dear Dr. Lu,

Can we find list of tertiary stacks from pdb by using x3DNA? like Example_stacks.dat for RNA.pdb file that I attached.

As I run this command
```
find_pair RNA.pdb bpfile.out
analyze bpfile.out 
```
it generate bunch of files like hstacking.pdb
but I don't know how to get that tertiary stacks list!

85

General discussions (Q&As) / Re: All Possible Base Pairs

« Last post by xiangjun on June 09, 2024, 10:34:29 pm »

Hi Parivash,

Thanks for your interest in using 3DNA. The find_pair -p command should give you a list of all pairs, canonical or not. Please provide a concrete example to illustrate what base pairs are missing.

As for the availability of x3dna-dssr, please see the post "No more grant funding for 3DNA/DSSR" (http://forum.x3dna.org/site-announcements/no-more-grant-funding-for-3dnadssr/). You could use http://skmatics.x3dna.org to analyze/visualize a structure using x3dna-dssr.

Hope this helps.

Xiang-Jun

86

General discussions (Q&As) / All Possible Base Pairs

« Last post by pfeyzi on June 09, 2024, 07:11:36 pm »

Dear Dr. Lu,
I hope this message finds you well.
I am currently using x3DNA to identify base pairs in my PDB files. I have been using the command
"find_pair -p X.pdb stdout | analyze stdin"
which provides me with the strongest base pairs for each residue. However, I am interested in identifying all possible base pairs, including both canonical and non-canonical pairs, regardless of their strength.
Is there a way to modify the command or use a different tool within x3DNA to obtain a comprehensive list of all possible base pairs for each residue? or can we change its constraints to include all pairs?
Additionally, I found in the new version of x3DNA, x3dna-dssr tool is not available. Is it possible to download the versions which includes that?
Thanks you so much,
Parivash

87

MD simulations / Re: Gromacs missing ' P ' atom

« Last post by xiangjun on May 27, 2024, 06:41:08 pm »

No, it is for information only: i.e., the first nucleotide (DG1) does not have the phosphate group.

88

MD simulations / Gromacs missing ' P ' atom

« Last post by mouxuank on May 27, 2024, 04:03:40 am »

When I used "find_pair 0.pdb | analyze" to analyze the Gromacs simulation output pdb file, I got the following tips, whether this affects the result and how I should solve the problem.

'''
handling file <0.pdb>

Time used: 00:00:00:00
missing ' P  ' atom : residue name ' DG', chain  , number [   1 ]
missing ' OP1' atom : residue name ' DG', chain  , number [   1 ]
missing ' OP2' atom : residue name ' DG', chain  , number [   1 ]
missing ' P  ' atom : residue name ' DG', chain  , number [   1 ]
missing ' OP1' atom : residue name ' DG', chain  , number [   1 ]
missing ' OP2' atom : residue name ' DG', chain  , number [   1 ]
missing ' P  ' atom : residue name ' DG', chain  , number [   1 ]
missing ' P  ' atom : residue name ' DG', chain  , number [   1 ]

Time used: 00:00:00:01
'''

89

RNA structures (DSSR) / Re: DSSR Basic Licence Application: Seeking Status Update and Assistance

« Last post by xiangjun on February 20, 2024, 06:02:31 pm »

Hi Junkai,

Thanks for the update. Getting DSSR-Basic, Academic license has been very straightforward from past experiences. As I heard from the CTV, your application has triggered a review of the license policy, and thus the delay. I am not sure of the exact details, but being patient seems to the best thing that can be done.

Let's stop this thread and put future communications via email.

Best regards,

Xiang-Jun

90

RNA structures (DSSR) / Re: DSSR Basic Licence Application: Seeking Status Update and Assistance

« Last post by junkaiWang on February 20, 2024, 01:15:50 pm »

Dear Xiang-Jun,

I'm writing to provide you with an update on my recent efforts to seek assistance.

Following the contact information provided on the Columbia Technology Venture (CTV) website, I reached out via email to techtransfer@columbia.edu in hopes of gaining support and guidance. Unfortunately, I have yet to receive a response from them. I have thoroughly checked my email records and ensured that the address was correctly spelled. I look forward to my project being able to use DSSR as soon as possible.

Thank you once again for your time and attention.

Best regards,

Junkai