Recent Posts

1

MD simulations / Re: Unnatural base pair helical parameters

« Last post by sarkagaku on October 03, 2020, 07:50:35 am »

Hi

Finally succeed in calculating helical base parameters for unnatural base pairs.
I used following procedure
1) converted gromacs trajectory to amber trajectory format using Amber CPPTRAJ
2)  Used modified cpptraj for unnatural base pairs
https://github.com/Amber-MD/cpptraj/pull/806

Thanks
Regards
Shaikh

2

General discussions (Q&As) / Re: blocview.pl

« Last post by dj on October 02, 2020, 09:21:57 am »

Thank you.   And I am also working with the newer version of the underlying functionality.     -David

3

General discussions (Q&As) / Re: blocview.pl

« Last post by xiangjun on September 30, 2020, 10:25:32 pm »

Within the 3DNA v2.4 distribution, the original Perl blocview script has been removed to avoid conflict with the Ruby script with the same name. The Ruby blocview script is the one to be used within 3DNA v2.0. Since you asked for the long outdated Perl script (no longer supported), I have dug it out -- see the attached file blocview.pl.

Note that DSSR 2.0 has replaced 3DNA v2.4. Specifically, the DSSR --blocview option has completely superseded the functionality of the Ruby blocview script in 3DNA v2.4, plus more advanced features. See the paper "DSSR-enabled innovative schematics of 3D nucleic acid structures with PyMOL" and http://skmatic.x3dna.org.

Best regards,

Xiang-Jun

4

General discussions (Q&As) / blocview.pl

« Last post by dj on September 30, 2020, 08:19:30 pm »

 I am looking for the blocview.pl perl script.    It does not seem to be in the x3dna-2.4 distribution.  How could I find it?   Thank you.   

5

General discussions (Q&As) / Re: changing some of the RNA sequence of an chain to DNA

« Last post by xiangjun on September 28, 2020, 11:10:37 am »

Hi,

Thanks for your followup -- it helps clarify previous ambiguities.

In 3DNA, you could perform base mutations without changing backbone geometry using the mutate_bases program. As an example, to mutate U6 to DT, you can do the following:

Code: [Select]

mutate_bases 'chain=A snum=6 m=DT' rna2.pdb mutated-U6DT.pdb
You may mutate all four bases simultaneously. Check mutate_bases -h. You then need to remove O2' atoms manually.

DSSR 2.0 has a much powerful modeling module that supersedes mutate_bases, with many more features.

HTH,

Xiang-Jun

6

General discussions (Q&As) / Re: changing some of the RNA sequence of an chain to DNA

« Last post by Sruthi0412 on September 27, 2020, 06:04:55 pm »

Sorry for not being clear in my first query.
 I have a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' .
I want to change the CAUA region to DNA bases. Basically, I want the sequence to be changed as DC DA DT DA (Nucleotides 4-8) , while all the other nucleotides are the same RNA sequences. I wanted to know if it is possible to do so in x3dna. I want to run some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand. I am attaching the RNA pdb here.

7

General discussions (Q&As) / Re: changing some of the RNA sequence of an chain to DNA

« Last post by xiangjun on September 27, 2020, 05:18:15 pm »

Please be specific: provide an example so that others can reproduce.

As a reminder, here is a list of items in the "Registration Agreement":

When posting on the Forum, please abide by the following rules:

0.  Do your homework; read the FAQ and browse the Forum.
1.  Ask your questions on the *public* 3DNA Forum instead of sending
        xiangjun emails or personal messages. Additionally, please note
        that your posts on the 3DNA Forum are in the *public domain*.
2.  Be specific with your questions; provide a minimal, reproducible
        example if possible; use attachments where appropriate.
3.  Respond to requests for clarification. Failure to do so may result in
        delay or no answer to your questions.
4.  Summarize the solution to your problem from a user's perspective
        by providing step-by-step details, for the community's benefit.
5+ Contribute back to the 3DNA project:
        o Report bugs — including typos
        o Make constructive suggestions — anything that can make 3DNA better
        o Answer other users' questions
        o Share your use cases in the "Users' contributions" section

Xiang-Jun

8

General discussions (Q&As) / changing some of the RNA sequence of an chain to DNA

« Last post by Sruthi0412 on September 27, 2020, 03:28:47 pm »

I am beginner in x3dna and wanted to know how to change a few of the RNA sequences in my RNA into DNA sequences. There are 20 nt in my chain and I want the bases 4-8 to be DNA. Could you give some guidelines regarding changing this

9

MD simulations / Re: Failed Downloading MD Ruby Scripts of 3DNA

« Last post by xiangjun on September 16, 2020, 10:38:01 am »

Hi Moi,

Thanks for sharing your way of applying DSSR to the analysis of MD trajectories. The protocol you described is exactly a DSSR user-case I have in mind. DSSR is not targeted specially for MD simulations, for sure. Yet, DSSR fits pragmatically in most situations involving DNA/RNA structural bioinformatics, by design. The MD community will realize the simplicity and applicability of DSSR: it is just a timing issue (when, but not if).

Meanwhile, I notice that, when numbering the stems, I guess the program number the stems by their residue number (from 5' to 3'), namely, the helix with smaller resid at 5' side will be numbered first... Is this correct?

Yes. Try DSSR on 1ehz or other examples you are sure of to check this out.

Xiang-Jun

10

MD simulations / Re: Failed Downloading MD Ruby Scripts of 3DNA

« Last post by Moi Zhang on September 16, 2020, 09:22:21 am »

Hi Xiang-jun,

Sorry for the late post. I was doing some other things and also understanding the usage of DSSR last week.

I am glad that I found out a way to apply DSSR on my trajectory without taking too much space.
The protocol is:
1. Divide the whole trajectory into let's say 1000 parts, and I would like to have 100 frames in one trajectory file. In my case, the simulation already divided the entire trajectory into small sections.
2. Use cpptraj to convert a single trajectory file into PDB file. Here, I only focus on DNA so I strip water and ions.
3. Run DSSR like

Code: [Select]

x3dna-dssr -i=production500.pdb -o=pro500.json --more --nmr --json. Like what you suggested, I use json output here.
4. Following the manual, I used jq tool to extract information from the json file I got on step 3. E.g.

Code: [Select]

jq '.models | .[] | .parameters.stems | .[] | {stem: .index, helical_direction: .helical_axis}’ <json file>.
5. Repeat the steps 2 to 4, and then I can retrieve helical axis information of the whole trajectory. Then I just need to concatenate them. Just make sure I only keep the useful files during the iteration so that I would not occupy too much space.

Meanwhile, I notice that, when numbering the stems, I guess the program number the stems by their residue number (from 5' to 3'), namely, the helix with smaller resid at 5' side will be numbered first... Is this correct?

Thanks so much:)

Best regards,
Moi