Topics

1

RNA structures (DSSR) / A pair is absent in dot-bracket notation ?

« on: November 24, 2023, 12:21:42 pm »

Hello,

when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.

Here is a copy of the output.

Code: [Select]

           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C21          G-C WC          19-XIX    cWW  cW-W
   2 A.G2           A.C20          G-C WC          19-XIX    cWW  cW-W
   3 A.C3           A.G19          C-G WC          19-XIX    cWW  cW-W
   4 A.G4           A.U18          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.U5           A.A17          U-A WC          20-XX     cWW  cW-W
   6 A.A7           A.U16          A-U --          --        cWW  cW-W
   7 A.G8           A.C15          G-C WC          19-XIX    cWW  cW-W
   8 A.G9           A.C14          G-C WC          19-XIX    cWW  cW-W

****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))

****************************************************************************