1
RNA structures (DSSR) / A pair is absent in dot-bracket notation ?
« on: November 24, 2023, 12:21:42 pm »
Hello,
when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.
Here is a copy of the output.
when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.
Here is a copy of the output.
Code: [Select]
DSSR: an Integrated Software Tool for
Dissecting the Spatial Structure of RNA
v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.G1 A.C21 G-C WC 19-XIX cWW cW-W
2 A.G2 A.C20 G-C WC 19-XIX cWW cW-W
3 A.C3 A.G19 C-G WC 19-XIX cWW cW-W
4 A.G4 A.U18 G-U Wobble 28-XXVIII cWW cW-W
5 A.U5 A.A17 U-A WC 20-XX cWW cW-W
6 A.A7 A.U16 A-U -- -- cWW cW-W
7 A.G8 A.C15 G-C WC 19-XIX cWW cW-W
8 A.G9 A.C14 G-C WC 19-XIX cWW cW-W
****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))
****************************************************************************