Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers

Messages - laura savana

Pages: [1]
1
RNA structures (DSSR) / Re: significance of character "P"
« on: August 28, 2018, 02:32:56 pm »
Thank you so much.
You cancelled my doubts.
I renew my congratulations also for the efficiency of this forum: you answer very quickly.
Thank you for all.

2
RNA structures (DSSR) / significance of character "P"
« on: August 28, 2018, 08:39:01 am »
Hello, I am new of this forum.
First of all I want to congratulate with Dr. Xiang-Jun Lu for his software and his website: software is very easy to use and can give out many informations, website explains in details every software feature.
I like use DSSR, but I have a question about his output sequences. In some of them appear "P" character: what means? I don't succed to find the answer. P isn't reported in IUPAC nomenclature or in other websites which contain informations about nomenclature of RNA sequence.
I show below an example ("P" is indicated in bold):
GCCGAUAUAGCUCAGuuGGuAGAGCAGCGCAUUCGUaAUGCGAAGgUCGUAGGtPCGACUCCUAUUAUCGGCACCA&a

In this example there is also another doubt that I can't explain me: there is a "t" (before "P"). Is there a sort of connection between "t" and "P"? If not, why appears "t" (I suppose stands for timine) if it's a RNA sequence?

Thank you so much for availability.

Pages: [1]

Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.