Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.8.1 (DSSR Manual) · Homepage · HIRING!

Messages - xiangjun

Pages: 1 ... 45 46 [47] 48 49 ... 67
1151
General discussions (Q&As) / Re: BI and BII conformations
« on: April 11, 2013, 08:54:36 am »
Thanks for your followup. After checking the source code carefully and a sample 3DNA output, I noticed that my previous reply is incomplete (inaccurate)  :(. Thus the discrepancy: you found that e-z can be negative in analyze -tor output, while I said that it's in range [0, 360] which should always be positive.

The missing piece is that the 3DNA reported difference (d=e-z) is the raw value, which can be positive or negative. Only for classifying a BI/BII conformation, negative d value is added 360 to make it positive; this simplify the code since the continuous range 20, 200 is checked for BII conformation.

Does this solve your puzzle? If still not, please post some concrete examples so we can walk them through to get to the bottom of the issue.

Xiang-Jun

1152
General discussions (Q&As) / Re: BI and BII conformations
« on: April 10, 2013, 05:16:41 pm »
It is a good question; the short answer is that the range of e-z is in [0, 360].

In 3DNA, the backbone BI/BII classification is based on e-z and works as below:
  • It follows the definition as given by IMB Jena, "Nucleic acid backbone parameters". Specifically,
    BI:  (epsilon-zeta) = -160° ... +20°
    BII: (epsilon-zeta) = +20° ... +200°
  • In 3DNA, all torsion angles are given in the range of [-180, +180]. To calculate e-z, epsilon and zeta are first converted to [0, 360]. If the difference (d=e-z) is < 0, then d=d+360. So d should be in [0, 360]. If d is in [20, 200], it is classified as BII, otherwise, BI.
Does that make sense? If you know of any more elaborate definition of the BI/BII conformations, please let me know.

Xiang-Jun

1153
Hi Pascal,

Thanks for your request for adding non-pairing nucleotide-nucleotide contacts (nt-nt) in 3DNA output. Currently, there is no such an option in 3DNA, but I do have this topic in mind for quite a while. It won't be hard to implement this functionality in DSSR/3DNA, so I will probably be able to get something done next week.

While we are at it, in addition to non-pairing nt-nt interactions via H-bond, how about those with only base-stacking? What output format would be prefer?

Xiang-Jun

1154
MD simulations / Re: Base stacking from x3dna_ensemble
« on: April 01, 2013, 12:06:03 pm »
Quote
theta  = arccos (dot(n1,n2)) where n1 and n2 are normal vectors from the b1n file

I wonder whether the angle I am getting is in radians?

You are getting the angle in radians instead of degrees. To verify, let n1 = [1, 0, 0]; n2 = [0, 0, 1], the angle should be 90 degrees.

Xiang-Jun

1155
General discussions (Q&As) / Re: zero or negative helical rise?
« on: March 28, 2013, 03:36:17 pm »
DSSR does not calculate helical/step parameters (at least not yet), as shown clearly in the enclosed file for 1xvk in my previous reply. See also my reply to "large deviations in output values".

In 3DNA distribution, there is also a program called 'cehs' (as in SCHNAaP) which uses RC8--YC6 as the bp long axis, and mean bp normal as the z-axis. In dinucleotide steps with non-canonical bps, 'cehs' normally provides a more 'sensible' rise/twist values. Please have a try on 1xvk and report back how it goes.

Xiang-Jun

1156
General discussions (Q&As) / Re: large deviations in output values
« on: March 27, 2013, 12:54:49 pm »
Quote
There are large deviations from average values in some of the parameters. Are the values real? What is the best way to view them in structures if so ?
The short answer is yes, they are 'real', as would be expected from 3DNA. The large deviations of 3DNA parameters for 3sj2 (and many other PDB entries) are due to non-canonical base pairs (bp). In the case of 3sj2, they are the three G+G pairs.

3DNA adopts the standard base reference frame, which is based on what would be a perfectly planar Watson-Crick (WC) bp geometry. Thus, by definition, WC pairs have the six bp parameters (Shear, Stretch, Stagger, Buckle, Propeller, Opening) close to zeros, with certain variations, mostly in Stagger, Buckle,  and Propeller. Non-canonical bps can have numerous ways to deviate from a WC bp; however, whatever the case, they can be rigorously quantified by the six rigid-body bp parameters. See the 3DNA NAR03 paper for details.

A non-cannonical bp not only has a set of characteristic bp parameters (see below for G+G bps in 3sj2), it could also greatly effect the (middle) bp reference frame used to derive the bp step and helical parameters. That's why you see large deviations of those parameters from normal WC steps (see below).

     bp        Shear    Stretch   Stagger    Buckle  Propeller  Opening
    3 G-U      -2.33     -0.47      0.13      2.30    -12.27      1.61
    4 C-G       0.22     -0.06     -0.00      3.70    -18.31      2.91
    5 C-G       0.22     -0.10      0.10      0.15     -4.59     -0.12
    6 G+G      -1.48     -3.61     -0.15     11.94      4.31     87.72

    step       Shift     Slide      Rise      Tilt      Roll     Twist
   4 CC/GG     -0.61     -1.97      3.29     -1.87      9.30     30.50
   5 CG/GG      0.04     -3.25     -1.34   -170.79     31.71    160.42
   6 GG/CG     -0.47     -3.69     -3.19    128.85   -110.61     97.02

3DNA derives a complete set of bp parameters to rigorously characterize the relative base geometry. For example, run the following 3DNA commands to see how 'analyze' and 'rebuild' complement each other to illustrate the point:
Code: [Select]
find_pair 3sj2.pdb stdout | analyze stdin
rebuild -atomic bp_step.par 3sj2-3dna.pdb
# superimpose '3sj2-3dna.pdb' onto '3sj2.pdb' using only base atoms, the rmsd would be ~0
find_pair 3sj2-3dna.pdb stdout | analyze stdin
# compare '3sj2-3dna.out' and '3sj2.out', the bp parameters are virtually identical

I see it as an advantage for 3DNA to report those 'weird' parameters, as it would (should) draw a user's attention. These bps and steps should be treated separately from the normal variations in structures (fragments) consisting of only WC bps. There could be ad hoc ways to made 'weird' values look normal, but they lack rigor and consistency. Again, see the 3DNA NAR03 paper for more info.

Note also that for a relatively straight duplex structure like 3sj2, 3DNA also output a set of "Global parameters based on C1'-C1' vectors:" as shown below, which you may find useful:
Code: [Select]
disp.: displacement of the middle C1'-C1' point from the helix
angle: inclination between C1'-C1' vector and helix (subtracted from 90)
twist: helical twist angle between consecutive C1'-C1' vectors
rise:  helical rise by projection of the vector connecting consecutive
       C1'-C1' middle points onto the helical axis

     bp       disp.    angle     twist      rise
   1 G-C      8.82     12.28     28.16      3.19
   2 G-C      8.09     11.46     32.47      2.62
   3 G-U      6.75     11.40     28.94      2.40
   4 C-G      7.06      8.02     31.16      2.87
   5 C-G      7.45      8.60     33.16      2.88
   6 G+G      7.07      7.95     29.95      2.72
   7 G-C      7.20      8.14     30.17      3.24
   8 C-G      6.86      9.94     34.81      2.83
   9 G+G      6.13     10.17     28.18      2.62
  10 G-C      6.56      6.75     33.11      2.91
  11 C-G      6.71      6.30     30.30      2.70
  12 G+G      6.05      9.99     33.37      2.80
  13 G-C      6.48     10.27     29.88      3.13
  14 G-C      6.82      7.48     27.46      2.97
  15 U-G      7.18      5.34     38.30      2.79
  16 C-G      7.16     10.13     26.27      2.90
  17 C-G      7.17     12.43      ---       ---

HTH,

Xiang-Jun

1157
RNA structures (DSSR) / Re: DSSR output - Base pair characteristics
« on: March 26, 2013, 01:33:06 pm »
Hi Jose,

Thanks for trying out DSSR and for your kind comment about the program. User feedback like yours is a great incentive for me to make DSSR a better tool to serve the RNA structure community.

To start with, I have tried hard to made DSSR easy to set up and play with. Based on my reading of literature in structural biology, I've made the DSSR output more intuitive (compared to previous 3DNA programs). For example, A.U2647 means U2647 on chain A. So far, I have not heard of any installation problem yet, and I am glad that you can make sense of most items in the DSSR output.

Your question regarding the meaning of the last column is well expected. It represents my own notation to specify a base pair, as elaborated below:
  • Each base has three edges: W for the Watson-Crick edge, M for the major groove edge, and m for the minor groove edge. M corresponds to the Hoogsteen (or C-H) edge of the Leontis-Westhof nomenclature, and for the majority of cases (where the glycosidic bond is anti) m agrees with the 'sugar' edge. Note that in DSSR, the edges are defined purely on the geometry of the base plane as would be in a Watson-Crick base pair, and it is not related to sugar. See my post "The chi (χ) torsion angle characterizes base/sugar relative orientation". The DSSR definition applies to RNA as well as DNA, with either syn or anti glycosidic bond.
  • In some boundary cases, the two bases in a pair may not be directly interacting edge-to-edge, where it is not straightforward to clearly designate which edge is involved. This is where the '.' comes in.
  • The DSSR notation contains 4 characters of the pattern: [ct][WMm.][+-][WMm.]. The third position is either '+' or '-', and it designates the relative orientation of the two bases (flipped or normal) as has been consistently used in 3DNA. For example, see the difference in A+U Hoogsteen pair vs. A-U Watson-Crick pair.
  • The first position is either 'c' for cis and 't' for trans of the two glycosidic bonds. It is defined by the 'virtual' torsion angle tor(N1-C1'-C1'-N9) reported in the DSSR output.

HTH,

Xiang-Jun

PS. Does "PDBID 3OXO" correspond to an RNA structure?

1158
General discussions (Q&As) / Re: zero or negative helical rise?
« on: March 25, 2013, 04:20:39 pm »
The issue you noticed with negative rise in 1xvk etc is due to the extensive non-canonical base pairs. Under such circumstance, as in more commonly seen in RNA structures, the meaning of base-pair step and helical parameters may not make (much) intuitive sense. Yet, these parameters are required to rigorously characterize the structure. Note that the base-pair parameters (Shear, Stretch, Stagger, Buckle, Propeller and Opening) still have their normal interpretation.

I'd recommend you use DSSR, which shows clearly the two Hoogsteen pairs, among other things, as show below. Check also files dssr-torsions.dat, dssr-pairs.pdb etc.

HTH,

Xiang-Jun

****************************************************************************
    DSSR: Software for Defining the (Secondary) Structures of RNA
      by Xiang-Jun Lu (xiangjun@x3dna.org), beta-r08-on-20130323

   The program is currently under active development. As always, we
   greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (http://forum.x3dna.org/), and I strive
   to promptly respond to any questions posted there.
****************************************************************************
Date and time: Mon Mar 25 16:15:39 2013
File name: 1xvk.pdb1
    no. of DNA/RNA chains: 1 [A=16]
    no. of nucleotides:    16
    no. of waters:         112
    no. of metals:         2 [Mg=2]
****************************************************************************
List of 8 base pair(s)
   1 1:A.DG1          2:A.DC8          [G+C]              00-n/a    cHW cM+W
       74.1(syn) C2'-endo lambda=47.5; -100.4(anti) C2'-endo lambda=61.6
       d(C1'-C1')=8.31 d(N1-N9)=6.64 d(C6-C8)=6.16 tor(N1-C1'-C1'-N9)=-0.1
       H-bonds[2]: "N7*N3[2.69]; O6(carbonyl)-N4(amino)[2.85]"
       bp_pars: [0.46    -3.41   -0.35   3.71    -5.92   67.37]
   2 1:A.DC2          2:A.DG7          [C-G] WC           19-XIX    cWW cW-W
       -103.9(anti) C4'-exo  lambda=55.5; -105.3(anti) C1'-exo  lambda=52.5
       d(C1'-C1')=10.53 d(N1-N9)=8.80 d(C6-C8)=9.65 tor(N1-C1'-C1'-N9)=0.0
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.76]; N3-N1(imino)[2.89]; N4(amino)-O6(carbonyl)[2.74]"
       bp_pars: [0.27    -0.18   0.35    -22.28  3.73    -2.75]
   3 1:A.DG3          2:A.DC6          [G-C] WC           19-XIX    cWW cW-W
       -108.4(anti) C1'-exo  lambda=54.1; -107.8(anti) C4'-exo  lambda=54.2
       d(C1'-C1')=10.47 d(N1-N9)=8.77 d(C6-C8)=9.65 tor(N1-C1'-C1'-N9)=-2.6
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.87]; N1(imino)-N3[2.88]; N2(amino)-O2(carbonyl)[2.81]"
       bp_pars: [-0.38   -0.18   0.41    22.84   2.54    -2.67]
   4 1:A.DT4          2:A.DA5          [T+A] Hoogsteen    23-XXIII  cWH cW+M
       -95.4(anti) C2'-endo lambda=59.7; 68.3(syn) C1'-exo  lambda=53.5
       d(C1'-C1')=8.37 d(N1-N9)=6.77 d(C6-C8)=6.17 tor(N1-C1'-C1'-N9)=0.5
       H-bonds[2]: "N3(imino)-N7[2.86]; O4(carbonyl)-N6(amino)[2.80]"
       bp_pars: [-0.69   3.57    0.31    -3.48   7.41    -70.55]
   5 1:A.DA5          2:A.DT4          [A+T] Hoogsteen    23-XXIII  cHW cM+W
       68.3(syn) C1'-exo  lambda=53.5; -95.4(anti) C2'-endo lambda=59.7
       d(C1'-C1')=8.37 d(N1-N9)=6.77 d(C6-C8)=6.17 tor(N1-C1'-C1'-N9)=0.5
       H-bonds[2]: "N7-N3(imino)[2.86]; N6(amino)-O4(carbonyl)[2.80]"
       bp_pars: [0.69    -3.57   -0.31   3.48    -7.41   70.54]
   6 1:A.DC6          2:A.DG3          [C-G] WC           19-XIX    cWW cW-W
       -107.8(anti) C4'-exo  lambda=54.2; -108.3(anti) C1'-exo  lambda=54.1
       d(C1'-C1')=10.47 d(N1-N9)=8.77 d(C6-C8)=9.65 tor(N1-C1'-C1'-N9)=-2.6
       H-bonds[3]: "O2(carbonyl)-N2(amino)[2.81]; N3-N1(imino)[2.88]; N4(amino)-O6(carbonyl)[2.87]"
       bp_pars: [0.38    -0.18   0.41    -22.84  2.54    -2.67]
   7 1:A.DG7          2:A.DC2          [G-C] WC           19-XIX    cWW cW-W
       -105.3(anti) C1'-exo  lambda=52.5; -103.9(anti) C4'-exo  lambda=55.5
       d(C1'-C1')=10.53 d(N1-N9)=8.80 d(C6-C8)=9.65 tor(N1-C1'-C1'-N9)=0.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.74]; N1(imino)-N3[2.89]; N2(amino)-O2(carbonyl)[2.76]"
       bp_pars: [-0.27   -0.18   0.35    22.28   3.73    -2.75]
   8 1:A.DC8          2:A.DG1          [C+G]              00-n/a    cWH cW+M
       -100.4(anti) C2'-endo lambda=61.5; 74.1(syn) C2'-endo lambda=47.6
       d(C1'-C1')=8.31 d(N1-N9)=6.64 d(C6-C8)=6.16 tor(N1-C1'-C1'-N9)=-0.1
       H-bonds[2]: "N3*N7[2.69]; N4(amino)-O6(carbonyl)[2.86]"
       bp_pars: [-0.46   3.41    0.35    -3.71   5.93    -67.37]
****************************************************************************
List of 1 helix
  helix=1[2] bps=8
   1 1:A.DG1          2:A.DC8          [G+C]              00-n/a    cHW cM+W
   2 1:A.DC2          2:A.DG7          [C-G] WC           19-XIX    cWW cW-W
   3 1:A.DG3          2:A.DC6          [G-C] WC           19-XIX    cWW cW-W
   4 1:A.DT4          2:A.DA5          [T+A] Hoogsteen    23-XXIII  cWH cW+M
   5 1:A.DA5          2:A.DT4          [A+T] Hoogsteen    23-XXIII  cHW cM+W
   6 1:A.DC6          2:A.DG3          [C-G] WC           19-XIX    cWW cW-W
   7 1:A.DG7          2:A.DC2          [G-C] WC           19-XIX    cWW cW-W
   8 1:A.DC8          2:A.DG1          [C+G]              00-n/a    cWH cW+M
****************************************************************************
List of 2 stems
  stem=1[#1] bps=2
   1 1:A.DC2          2:A.DG7          [C-G] WC           19-XIX    cWW cW-W
   2 1:A.DG3          2:A.DC6          [G-C] WC           19-XIX    cWW cW-W

  stem=2[#1] bps=2
   1 1:A.DC6          2:A.DG3          [C-G] WC           19-XIX    cWW cW-W
   2 1:A.DG7          2:A.DC2          [G-C] WC           19-XIX    cWW cW-W
****************************************************************************
List of 1 coaxial stack(s)
   1 Helix#1 contains 2 stems: [#1, #2]
****************************************************************************
List of 1 internal loop(s)
   1 symmetric internal loop: 8 nts; [2x2]; linked by [#1, #2]
       1:A.DG3+1:A.DT4+1:A.DA5+1:A.DC6+2:A.DG3+2:A.DT4+2:A.DA5+2:A.DC6 [GTACGTAC]
****************************************************************************
>chain-A #1 DNA* with 16 nts
GCGTACGCGCGTACGC
.((..((..))..)).

1159
Thanks for pointing out the PDB id (2kd4) of the structure you are interested in, and attaching the corresponding 3DNA output files. As always, such information is useful by making our discussions concrete.

Browsing through the output file (2kd4.out) and looking at the structure with Jmol, it appears to me 3DNA has no problem to analyze this structure.

First, the twist angles associate with intercalated steps are smaller, while those for the flanking steps are larger, than normal A-DNA twist values.

Local base-pair step parameters
    step       Shift     Slide      Rise      Tilt      Roll     Twist
   1 GC/GC      1.21      0.19      3.77      5.32    -16.06      9.14
   2 CC/GG      0.42     -1.82      4.09    -13.22      0.06     37.79
  3 CG/CG     -0.08     -1.17      6.68     -7.87    -11.95     20.28
   4 GC/GC      0.07     -0.19      3.40      0.22     -0.57     49.80
  5 CG/CG     -0.14     -1.18      6.62      3.50     -6.88     21.72
   6 GG/CC      0.16     -1.82      3.69     14.10     12.69     39.30
   7 GC/GC     -1.33      0.15      3.44     -6.43    -13.80      6.98

Second, the output for the sugar torsion angles are also as expected (see below for the output for strand I). Because of the 2'--5' backbone linkage, angles alpha [O3'(i-1)-P-O5'-C5'], epsilon [C4'-C3'-O3'-P(i+1)] and zeta [C3'-O3'-P(i+1)-O5'(i+1)] are not defined in the conventional sense.

Strand I
  base    alpha    beta   gamma   delta  epsilon   zeta    chi
   1 G     ---     ---   -135.8   105.5    ---     ---     18.3
   2 C     ---    145.3    62.2    86.8    ---     ---   -126.7
   3 C     ---    176.8   -35.2   134.4    ---     ---   -103.9
   4 G     ---    115.9    64.8    61.7    ---     ---   -137.3
   5 C     ---    163.8    48.4   113.5    ---     ---   -114.8
   6 G     ---    178.6    50.6    83.4    ---     ---   -120.9
   7 G     ---   -149.2    33.4   139.0    ---     ---    -83.2
   8 C     ---    154.9    20.2   120.1    ---     ---   -132.2


Note the following output from find_pair:
Code: [Select]
^^vv opposite bp direction: 1(8) 1(1)-2(2)
^^vv opposite bp direction: 1(8) 7(7)-8(8)

I have attached the stacking diagram of the first step, where one can see clearly the two base pairs have opposite orientation. The same is true for the last step. Such base flapping occurs around B-Z junctions, as in 2acj. I do not know how reliable this part of the structure is, or its relevance.

You may also want to analyze this structure (or related ones) using Curves+. I noticed that Horowitz et al. used Curves to analyze 2kd4 in their JACS publication.

HTH,

Xiang-Jun

1160
Could you try 3DNA on the structure you linked to ("Solution Structure and Thermodynamics of 2′,5′ RNA Intercalation"), and report back any problem you have?

Xiang-Jun

PS: In posting a question, it'd be very helpful to attach a structure file, or provide a PDB id.

1161
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 19, 2013, 12:36:23 am »
Hi Marc,

I've just released DSSR beta-r06-on-20130319 which should have fixed the "segmentation fault" bug for PDB entry 2a64. I've also taken this opportunity to update the -h (--help) message.

Have a try and report back how it goes!

Xiang-Jun

1162
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 18, 2013, 01:33:30 pm »
Hi Marc,

Thanks for trying out DSSR and reporting back a bug with the 64-bits unix version of beta-r05-on-20130316 on PDB entry 2a64. I've verified the bug and will get it fixed ASAP.

I've also tried the same 2a64 entry with the Mac OS X version without the reported problem. Since the "Segmentation fault (core dumped)" occurs after the output of "total number of junctions: 4", it is likely due to the ribose zipper detection function recently added into DSSR.

In any event, keep testing and report back any further issues you encounter. Also stay tuned for the next release! :)

Xiang-Jun

1163
RNA structures (DSSR) / Re: DSSR - List of bases involved in hairpins?
« on: March 14, 2013, 03:29:27 pm »
I've just updated DSSR to beta-r04-on-20130314. Among other things, now all nucleotides in hairpin loops are explicitly listed in addition to information reported before. So for 1msy, the new output looks like below:

Code: [Select]
List of 1 hairpin loop(s)
   1 nts=4 GUAA closed by pair {A.C2658+A.G2663 [CG], #-1}
       A.C2658+A.G2659+A.U2660+A.A2661+A.A2662+A.G2663 [CGUAAG]

I have some reasons to report hairpin loops differently from other types of loops (bulges, internal loops, junctions), one being to follow the convention. For example, at first glance, one would immediately see that 1msy contains a GUAA tetra-loop (of the most common GNRA type).

I am not aware of a consistent way to name other loops in the literature of RNA structures, so I've come up with my own convention. I'd like to hear what the community has to say when DSSR gains more popularity in the RNA structural world, and make adjustments accordingly.

HTH,

Xiang-Jun

1164
RNA structures (DSSR) / Re: DSSR - List of bases involved in hairpins?
« on: March 12, 2013, 06:40:11 pm »
Thanks for your feedback. I will get DSSR updated in a couple of days, where the requested info will be added to hairpin loops. In the meantime, please test DSSR more thoroughly and report back your thoughts that would make it better tool from a user's perpective.

Best regards,

Xiang-Jun

1165
Thanks for downloading the beta testing version of DSSR. I am working on a manuscript, and more details will be made available in due course. In the meantime, here is a short answer to your questions:

  • DSSR defines a helix from purely a base stacking perspective, regardless of base-pair type or backbone connection. So the tRNA example (1ehz) has two helices, corresponding to the two arms of the stereotypical L-shaped tertiary structure.
  • The stem are further restricted by canonical base pairs (Watson-Crick and G-U wobble), and backbone connections (each strand treated separately). So the same tRNA (1ehz) has four stems, corresponding to the famous tRNA cloverleaf secondary structure.
  • The shortest helix or stem is composed of two base pairs. DSSR does not define a separate class of 'step'.
  • As you may have observed in the two example output files, DSSR does treat lone (isolated) Watsoc-Crick (or G-U wobble) base pair separately.

The default settings currently adopted in DSSR are based on my understanding of the conventions in the RNA structural world. I'd like to hear what users have to say and will make refinements accordingly. More functionality will be added the DSSR; with the current beta release, I've just kicked the ball rolling. Based on experience of supporting 3DNA and using other bioinformatics tools, I've created DSSR from the ground up to be trivial to set up and easy to use. Just play with it, and report back any issues you have.

HTH,

Xiang-Jun

1166
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 09, 2013, 04:06:55 pm »
Following my previous post, I've just released DSSR beta-r03-on-20130309. I tested this version against all nucleic-acid-containing structures in the PDB, so all the bugs you reported yesterday should have been fixed. I was actually approaching the end of such an extensive tests when I say your post, and your reported cases were already handled at that time.

It's worthy noting that some of the DSSR buggy cases are due to problematic data quality of the corresponding PDB entries. For example, 1bdn apparently have two structures overlapped (with 4 chains instead of 2) -- check the structure with PyMOL or Jmol, and you will seem my point.

While more bugs are bound to be uncovered, and further refinements are necessary, I am confident to say that DSSR (beta-r03-on-20130309) is robust enough for real-world applications. As always, do not be shy to report back any issues you encounter.

Xiang-Jun

1167
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 08, 2013, 04:42:50 pm »
I wholeheartedly welcome bug reports, and this latest is of no exception :). I'll get them fixed shortly -- hopefully by tomorrow. With the next release, the program would be quite robust, I believe.

Have a great weekend.

Xiang-Jun

1168
General discussions (Q&As) / Re: Install 3DNA v2.1 on Windows
« on: March 07, 2013, 09:08:04 pm »
Did you read the post "How to install 3DNA on Linux and Windows?". The last part is about installing 3DNA "On MinGW/MSYS--based Windows".

HTH,

Xiang-Jun

1169
General discussions (Q&As) / Re: plot to show DNA conformation
« on: March 07, 2013, 09:21:25 am »
I'd suggest that you pay attention to the Zp parameter, along with some other more commonly used ones.

Good luck with you research!

Xiang-Jun

1170
General discussions (Q&As) / Re: plot to show DNA conformation
« on: March 06, 2013, 12:28:44 pm »
Hi Harry,

Thanks for posting on the Forum. 3DNA per se does not generate Ramachandran-like plot for DNA or RNA, or any plot of that kind. It calculates various structural parameters that can be plotted using third-party tools. Regarding Ramachandran-like plot for RNA (based on pseudo torsion angles), you may check papers from the Pyle lab.

3DNA v2.1 has a new option "analyze -torsion" to calculate commonly used torsion angles, including the following section:

Code: [Select]
Pseudo (virtual) eta/theta torsion angles:

Note: eta:    C4'(i-1)-P(i)-C4'(i)-P(i+1)
      theta:  P(i)-C4'(i)-P(i+1)-C4'(i+1)

      eta':   C1'(i-1)-P(i)-C1'(i)-P(i+1)
      theta': P(i)-C1'(i)-P(i+1)-C1'(i+1)

      eta":   Borg(i-1)-P(i)-Borg(i)-P(i+1)
      theta": P(i)-Borg(i)-P(i+1)-Borg(i+1)

To follow DNA conformational changes, you may find our 2000 JMB paper titled "A-form conformational motifs in ligand-bound DNA structures" relevant. The work examined a variety of parameters, and found Zp to be the most discriminative between A- and B-form DNAs.

Furthermore, 3DNA v2.1 has a Ruby script x3dna_ensemble that makes analysis of MD simulation trajectories straightforward. We have a new 3DNA JoVE paper in press that provides protocols for such MD analysis.

HTH,

Xiang-Jun

 

1171
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 06, 2013, 12:05:45 pm »
Hi,

All the bugs you reported should have been fixed, and DSSR beta-r02-on-20130306 released. Please have a try and report back how it goes.

As you may notice, I have split the thread from the original DSSR announcement post. I also put the long list of buggy cases reported in your second post into the code tag for easy browsing.

Do not be shy in bringing up more bugs --- the more, the merrier!  :D

Xiang-Jun

1172
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 04, 2013, 02:48:19 pm »
Hi,

Thanks for using DSSR, and reporting back the issues you experienced. I will look into them and release an updated version shortly. Stay tuned  :D

Xiang-Jun

1173
Note added on March 28, 2015: Please visit "DSSR: Dissecting the Spatial Structure of RNA"


As the number of experimentally solved RNA-containing structures grows, it is becoming increasingly important to characterize the geometric features of the molecules consistently and efficiently. Existing RNA bioinformatics tools are fragmented, and suffer in either scope or usability. DSSR, a new 3DNA program for Defining the Secondary Structures of RNA from three-dimensional (3D) coordinates, is designed to streamline the analyses of 3D RNA structures. It consolidates, refines, and significantly extends the functionality of 3DNA for RNA structural analysis.

Starting from an RNA structure in PDB or PDBx/mmCIF format, DSSR employs a set of simple geometric criteria to identify all existent base pairs (bp): either canonical Watson-Crick and wobble pairs or non-canonical pairs with at least one hydrogen bond. The latter pairs may include normal or modified bases, regardless of tautomeric or protonation state. DSSR uses the six standard rigid-body bp parameters (shear, stretch, stagger, propeller, buckle, and opening) to rigorously quantify the spatial disposition of any two interacting bases. Where applicable, the program also denotes a bp by common names, the Saenger classification scheme of 28 H-bonding types, and the Leontis-Westhof nomenclature of 12 basic geometric classes.

DSSR detects multiplets (triplets or higher-order base associations) by searching horizontally in the plane of the associated bp for further H-bonding interactions. The program determines double-helical regions by exploring vertically in the neighborhood of selected bps for base-stacking interactions, regardless of backbone connection (e.g., coaxial stacking of helices). DSSR then identifies hairpin loops, bulges, internal loops, and multi-branch loops (junctions), and recognizes the existence of pseudo-knots. The program outputs RNA secondary structure in dot-bracket notation (dbn) and connect table (.ct) format that can be fed directly into visualization tools (such as VARNA).

DSSR classifies dinucleotide steps into the most common A-, B-, or Z-form double helices, calculates commonly used backbone torsion angles, and assigns the consensus RNA backbone suite names. The program also identifies A-minor interactions, ribose zippers, G quartets, kissing loops, U-turns, and kink-turns. Furthermore, it reports non-pairing interactions (H-bonding or base-stacking) between two nucleotides, and contacts involving phosphate groups.

Currently at version 1.2, DSSR is in a stable and mature state. A simple web interface and a comprehensive user manual are available. Supported by Dr. Robert Hanson, DSSR has recently been integrated into Jmol, a popular molecular graphics program. DSSR-related news and information can be found on the 3DNA homepage. Questions and suggestions are always welcome on the 3DNA forum.

Give DSSR a try, compare it with similar tools in terms of usability, functionality and support, and see the differences!

Current version: DSSR v1.2.5-2015mar19. Release history (in reverse chronological order)



List of users who has helped improve DSSR by reporting bugs, making comments/suggestions etc:

jyvdf3asdg2; kailsen; MarcParisien; jctoledo; Auffinger; febos; acolasanti; hansonr; cllawson; cllawson; Sylverlin

-- Xiang-Jun


Note: please start a new topic with a more specific title; do not post directly below this announcement.


Here are some sample runs (see x3dna-dssr -h for more info),
Code: [Select]
x3dna-dssr -i=1msy.pdb -o=1msy.out  # 27 nts
x3dna-dssr --input=1msy.pdb --output=1msy.out # as as above
x3dna-dssr -i=1ehz.pdb -o=1ehz.out  # tRNA, 76 nts
x3dna-dssr -i=1jj2.pdb -o=1jj2.out  # rRNA, 2876 nts

Example #1: GUAA tetraloop mutant of Sarcin/Ricin domain from E. Coli 23 S rRNA (1msy)

Code: [Select]
Run: x3dna-dssr -i=1msy.pdb -o=1msy.out --non-pair --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1msy.pdb --u-turn --non-pair -o=1msy.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1msy.pdb
    no. of DNA/RNA chains: 1 [A=27]
    no. of nucleotides:    27
    no. of atoms:          685
    no. of waters:         109
    no. of metals:         0

****************************************************************************
List of 13 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.U2647        A.G2673        U-G Wobble      28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble      28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC          19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC          20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC          19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC          19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --          n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --          n/a       tHH  tM+M
   9 A.G2655        A.U2656        G+U Platform    n/a       cSH  cm+M
  10 A.U2656        A.A2665        U-A rHoogsteen  24-XXIV   tWH  tW-M
  11 A.A2657        A.G2664        A-G Sheared     11-XI     tHS  tM-m
  12 A.C2658        A.G2663        C-G WC          19-XIX    cWW  cW-W
  13 A.G2659        A.A2662        G-A Sheared     11-XI     tSH  tm-M

****************************************************************************
List of 1 multiplet
   1 nts=3 GUA A.G2655,A.U2656,A.A2665

****************************************************************************
List of 1 helix
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[1] bps=12
      strand-1 5'-UGCUCCUAUACG-3'
       bp-type    ||||||....|.
      strand-2 3'-GUGAGGCCAGGA-5'
      helix-form  ..AAA..x...
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --           n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --           n/a       tHH  tM+M
   9 A.U2656        A.A2665        U-A rHoogsteen   24-XXIV   tWH  tW-M
  10 A.A2657        A.G2664        A-G Sheared      11-XI     tHS  tM-m
  11 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W
  12 A.G2659        A.A2662        G-A Sheared      11-XI     tSH  tm-M

****************************************************************************
List of 1 stem
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=6
      strand-1 5'-UGCUCC-3'
       bp-type    ||||||
      strand-2 3'-GUGAGG-5'
      helix-form  ..AAA
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 30 non-pairing interactions
   1 A.U2647        A.G2648        stacking: 1.0(0.5)--pm(>>,forward)
   2 A.G2648        A.C2649        stacking: 7.3(4.6)--pm(>>,forward)
   3 A.G2648        A.G2673        stacking: 2.0(0.2)--mm(<>,outward)
   4 A.C2649        A.U2650        stacking: 2.8(1.1)--pm(>>,forward)
   5 A.U2650        A.C2651        stacking: 0.6(0.0)--pm(>>,forward)
   6 A.C2651        A.C2652        stacking: 0.5(0.1)--pm(>>,forward)
   7 A.C2652        A.U2653        stacking: 5.2(2.6)--pm(>>,forward)
   8 A.C2652        A.G2669        stacking: 0.2(0.0)--mm(<>,outward)
   9 A.U2653        A.A2654        stacking: 3.3(2.0)--pp(><,inward) H-bonds[1]: "OP2-O2'(hydroxyl)[2.62]"
  10 A.A2654        A.U2656        stacking: 3.7(1.1)--mm(<>,outward) H-bonds[1]: "O4'*O4'[3.05]"
  11 A.G2655        A.G2664        stacking: 4.4(2.2)--pp(><,inward) H-bonds[1]: "O2'(hydroxyl)-O6(carbonyl)[3.09]"
  12 A.G2655        A.A2665        H-bonds[3]: "N1(imino)-OP2[2.77],N2(amino)-OP2[3.34],N2(amino)-O5'[2.89]"
  13 A.U2656        A.G2664        H-bonds[2]: "OP2-N1(imino)[3.04],OP2-N2(amino)[2.94]"
  14 A.A2657        A.C2658        stacking: 6.7(2.6)--pm(>>,forward)
  15 A.A2657        A.A2665        stacking: 3.7(3.3)--mm(<>,outward)
  16 A.C2658        A.G2659        stacking: 0.4(0.1)--pm(>>,forward)
  17 A.G2659        A.A2661        H-bonds[1]: "O2'(hydroxyl)-N7[2.60]"
  18 A.G2659        A.G2663        stacking: 3.9(1.2)--mm(<>,outward)
  19 A.U2660        A.A2661        stacking: 7.5(4.2)--pm(>>,forward)
  20 A.A2661        A.A2662        stacking: 6.3(4.4)--pm(>>,forward)
  21 A.G2663        A.G2664        stacking: 2.7(0.6)--pm(>>,forward)
  22 A.G2664        A.A2665        H-bonds[1]: "O2'(hydroxyl)-O4'[2.75]"
  23 A.A2665        A.C2666        stacking: 1.6(1.1)--pm(>>,forward)
  24 A.C2666        A.C2667        stacking: 4.3(2.1)--pm(>>,forward)
  25 A.C2667        A.G2668        stacking: 3.1(1.0)--pm(>>,forward)
  26 A.G2668        A.G2669        stacking: 4.3(3.0)--pm(>>,forward)
  27 A.G2669        A.A2670        stacking: 4.3(2.9)--pm(>>,forward)
  28 A.A2670        A.G2671        stacking: 1.5(1.5)--pm(>>,forward)
  29 A.G2671        A.U2672        stacking: 7.4(4.0)--pm(>>,forward)
  30 A.U2672        A.G2673        H-bonds[1]: "O2'(hydroxyl)-O4'[3.37]"

****************************************************************************
List of 4 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=3 UAA A.U2660,A.A2661,A.A2662
   2 nts=4 CUAU A.C2652,A.U2653,A.A2654,A.U2656
   3 nts=4 GGGG A.G2655,A.G2664,A.G2663,A.G2659
   4 nts=6 CAACCG A.C2658,A.A2657,A.A2665,A.C2666,A.C2667,A.G2668

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 1 hairpin loop
   1 hairpin loop: nts=6; [4]; linked by [#-1]
     nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
       nts=4 GUAA A.G2659,A.U2660,A.A2661,A.A2662

****************************************************************************
List of 1 internal loop
   1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#-1]
     nts=13 CUAGUACGGACCG A.C2652,A.U2653,A.A2654,A.G2655,A.U2656,A.A2657,A.C2658,A.G2663,A.G2664,A.A2665,A.C2666,A.C2667,A.G2668
       nts=5 UAGUA A.U2653,A.A2654,A.G2655,A.U2656,A.A2657
       nts=4 GACC A.G2664,A.A2665,A.C2666,A.C2667

****************************************************************************
List of 1 U-turn
   1  A.G2659-A.A2662 H-bonds[2]: "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]" nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1msy nts=27 [whole]
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))
>1msy-A #1 nts=27 [chain] RNA
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-iloops.pdb -- an ensemble of internal loops
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Example #2: The crystal structure of yeast phenylalanine tRNA at 1.93 Å resolution (1ehz)

Code: [Select]
Run: x3dna-dssr -i=1ehz.pdb -o=1ehz.out --po4 --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1ehz.pdb --u-turn --po4 -o=1ehz.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1ehz.pdb
    no. of DNA/RNA chains: 1 [A=76]
    no. of nucleotides:    76
    no. of atoms:          1821
    no. of waters:         160
    no. of metals:         9 [Mg=6,Mn=3]

****************************************************************************
List of 11 types of 14 modified nucleotides
      nt    count  list
   1 1MA-a    1    A.1MA58
   2 2MG-g    1    A.2MG10
   3 5MC-c    2    A.5MC40,A.5MC49
   4 5MU-t    1    A.5MU54
   5 7MG-g    1    A.7MG46
   6 H2U-u    2    A.H2U16,A.H2U17
   7 M2G-g    1    A.M2G26
   8 OMC-c    1    A.OMC32
   9 OMG-g    1    A.OMG34
  10 PSU-P    2    A.PSU39,A.PSU55
  11 YYG-g    1    A.YYG37

****************************************************************************
List of 34 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.G1           A.C72          G-C WC          19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC          19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC          19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC          20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC          20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC          20-XX     cWW  cW-W
   8 A.U8           A.A14          U-A rHoogsteen  24-XXIV   tWH  tW-M
   9 A.U8           A.A21          U+A --          n/a       tSW  tm+W
  10 A.A9           A.A23          A+A --          02-II     tHH  tM+M
  11 A.2MG10        A.C25          g-C WC          19-XIX    cWW  cW-W
  12 A.2MG10        A.G45          g+G --          n/a       cHS  cM+m
  13 A.C11          A.G24          C-G WC          19-XIX    cWW  cW-W
  14 A.U12          A.A23          U-A WC          20-XX     cWW  cW-W
  15 A.C13          A.G22          C-G WC          19-XIX    cWW  cW-W
  16 A.G15          A.C48          G+C rWC         22-XXII   tWW  tW+W
  17 A.H2U16        A.U59          u+U --          n/a       tSW  tm+W
  18 A.G18          A.PSU55        G+P --          n/a       tWS  tW+m
  19 A.G19          A.C56          G-C WC          19-XIX    cWW  cW-W
  20 A.G22          A.7MG46        G-g --          07-VII    tHW  tM-W
  21 A.M2G26        A.A44          g-A Imino       08-VIII   cWW  cW-W
  22 A.C27          A.G43          C-G WC          19-XIX    cWW  cW-W
  23 A.C28          A.G42          C-G WC          19-XIX    cWW  cW-W
  24 A.A29          A.U41          A-U WC          20-XX     cWW  cW-W
  25 A.G30          A.5MC40        G-c WC          19-XIX    cWW  cW-W
  26 A.A31          A.PSU39        A-P --          n/a       cWW  cW-W
  27 A.OMC32        A.A38          c-A --          n/a       c.W  c.-W
  28 A.U33          A.A36          U-A --          n/a       tSH  tm-M
  29 A.5MC49        A.G65          c-G WC          19-XIX    cWW  cW-W
  30 A.U50          A.A64          U-A WC          20-XX     cWW  cW-W
  31 A.G51          A.C63          G-C WC          19-XIX    cWW  cW-W
  32 A.U52          A.A62          U-A WC          20-XX     cWW  cW-W
  33 A.G53          A.C61          G-C WC          19-XIX    cWW  cW-W
  34 A.5MU54        A.1MA58        t-a rHoogsteen  24-XXIV   tWH  tW-M

****************************************************************************
List of 4 multiplets
   1 nts=3 UAA A.U8,A.A14,A.A21
   2 nts=3 AUA A.A9,A.U12,A.A23
   3 nts=3 gCG A.2MG10,A.C25,A.G45
   4 nts=3 CGg A.C13,A.G22,A.7MG46

****************************************************************************
List of 2 helices
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[2] bps=15
      strand-1 5'-GCGGAUUcUGUGtPC-3'
       bp-type    ||||||||||||..|
      strand-2 3'-CGCUUAAGACACaGG-5'
      helix-form  AA....xAAAAxx.
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
   8 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   9 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
  10 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
  11 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
  12 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W
  13 A.5MU54        A.1MA58        t-a rHoogsteen   24-XXIV   tWH  tW-M
  14 A.PSU55        A.G18          P+G --           n/a       tSW  tm+W
  15 A.C56          A.G19          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  helix#2[2] bps=15
      strand-1 5'-AAPcUGGAgCUCAGu-3'
       bp-type    ...||||.||||...
      strand-2 3'-UcAGACCgCGAGUCU-5'
      helix-form  x..AAAAxAA.xxx
   1 A.A36          A.U33          A-U --           n/a       tHS  tM-m
   2 A.A38          A.OMC32        A-c --           n/a       cW.  cW-.
   3 A.PSU39        A.A31          P-A --           n/a       cWW  cW-W
   4 A.5MC40        A.G30          c-G WC           19-XIX    cWW  cW-W
   5 A.U41          A.A29          U-A WC           20-XX     cWW  cW-W
   6 A.G42          A.C28          G-C WC           19-XIX    cWW  cW-W
   7 A.G43          A.C27          G-C WC           19-XIX    cWW  cW-W
   8 A.A44          A.M2G26        A-g Imino        08-VIII   cWW  cW-W
   9 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
  10 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
  11 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
  12 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  13 A.A14          A.U8           A-U rHoogsteen   24-XXIV   tHW  tM-W
  14 A.G15          A.C48          G+C rWC          22-XXII   tWW  tW+W
  15 A.H2U16        A.U59          u+U --           n/a       tSW  tm+W

****************************************************************************
List of 4 stems
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=7
      strand-1 5'-GCGGAUU-3'
       bp-type    |||||||
      strand-2 3'-CGCUUAA-5'
      helix-form  AA....
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
  --------------------------------------------------------------------------
  stem#2[#2] bps=4
      strand-1 5'-gCUC-3'
       bp-type    ||||
      strand-2 3'-CGAG-5'
      helix-form  AA.
   1 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
   2 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
   3 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
   4 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#3[#2] bps=4
      strand-1 5'-CCAG-3'
       bp-type    ||||
      strand-2 3'-GGUc-5'
      helix-form  AAA
   1 A.C27          A.G43          C-G WC           19-XIX    cWW  cW-W
   2 A.C28          A.G42          C-G WC           19-XIX    cWW  cW-W
   3 A.A29          A.U41          A-U WC           20-XX     cWW  cW-W
   4 A.G30          A.5MC40        G-c WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#4[#1] bps=5
      strand-1 5'-cUGUG-3'
       bp-type    |||||
      strand-2 3'-GACAC-5'
      helix-form  AAAA
   1 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   2 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
   3 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
   4 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
   5 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.G19          A.C56          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 2 coaxial stacks
   1 Helix#1 contains 2 stems: [#1,#4]
   2 Helix#2 contains 2 stems: [#3,#2]

****************************************************************************
List of 11 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=2 Uc A.U7,A.5MC49
   2 nts=2 UC A.U8,A.C13
   3 nts=2 GA A.G65,A.A66
   4 nts=3 CgC A.C25,A.M2G26,A.C27
   5 nts=3 gAC A.7MG46,A.A21,A.C48
   6 nts=3 GtP A.G53,A.5MU54,A.PSU55
   7 nts=4 GACC A.G1,A.A73,A.C74,A.C75
   8 nts=4 GAcU A.G30,A.A31,A.OMC32,A.U33
   9 nts=5 GGGaC A.G19,A.G57,A.G18,A.1MA58,A.C61
  10 nts=7 gAAgAPc A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
  11 nts=9 GAGAGAGUC A.G43,A.A44,A.G45,A.A9,A.G22,A.A14,A.G15,A.U59,A.C60
     -----------------------------------------------------------------------
  Nucleotides not involved in stacking interactions
     nts=4 uGUA A.H2U17,A.G20,A.U47,A.A76

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 3 hairpin loops
   1 hairpin loop: nts=10; [8]; linked by [#2]
     nts=10 CAGuuGGGAG A.C13,A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21,A.G22
       nts=8 AGuuGGGA A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21
   2 hairpin loop: nts=11; [9]; linked by [#3]
     nts=11 GAcUgAAgAPc A.G30,A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
       nts=9 AcUgAAgAP A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39
   3 hairpin loop: nts=9; [7]; linked by [#4]
     nts=9 GtPCGaUCC A.G53,A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60,A.C61
       nts=7 tPCGaUC A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60

****************************************************************************
List of 1 junction
   1 4-way junction: nts=16; [2,1,5,0]; linked by [#1,#2,#3,#4]
     nts=16 UUAgCgCGAGgUCcGA A.U7,A.U8,A.A9,A.2MG10,A.C25,A.M2G26,A.C27,A.G43,A.A44,A.G45,A.7MG46,A.U47,A.C48,A.5MC49,A.G65,A.A66
       nts=2 UA A.U8,A.A9
       nts=1 g A.M2G26
       nts=5 AGgUC A.A44,A.G45,A.7MG46,A.U47,A.C48
       nts=0

****************************************************************************
List of 1 non-loop single-stranded segment
   1 nts=4 ACCA A.A73,A.C74,A.C75,A.A76

****************************************************************************
List of 1 kissing loop interaction
   1 isolated-pair #-1 between hairpin loops #1 and #3

****************************************************************************
List of 2 U-turns
   1  A.U33-A.A36 H-bonds[1]: "N3(imino)-OP2[2.80]" nts=6 cUgAAg A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37
   2  A.PSU55-A.1MA58 H-bonds[1]: "N3-OP2[2.77]" nts=6 tPCGaU A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59

****************************************************************************
List of 18 phosphate interactions
   1 A.U7            OP1-hbonds[1]: "MG@A.MG580[2.60]"
   2 A.A9            OP2-hbonds[1]: "N4@A.C13[3.01]"
   3 A.A14           OP2-hbonds[1]: "MG@A.MG580[1.93]"
   4 A.H2U16         OP2-cap: "A.H2U16"
   5 A.G18           OP1-hbonds[1]: "O2'@A.H2U17[2.97]"
   6 A.G19           OP1-hbonds[2]: "N4@A.C60[3.27],MN@A.MN530[2.19]"
   7 A.G20           OP1-hbonds[1]: "MG@A.MG540[2.07]"
   8 A.A21           OP2-hbonds[1]: "MG@A.MG540[2.11]"
   9 A.A23           OP2-hbonds[1]: "N6@A.A9[3.12]"
  10 A.A35           OP2-cap: "A.U33"
  11 A.A36           OP2-hbonds[1]: "N3@A.U33[2.80]"
  12 A.YYG37         OP2-hbonds[1]: "MG@A.MG590[2.53]"
  13 A.C48           OP2-hbonds[1]: "O2'@A.7MG46[3.55]"
  14 A.5MC49         OP1-hbonds[1]: "O2'@A.C48[3.13]" OP2-hbonds[1]: "O2'@A.U7[2.68]"
  15 A.U50           OP1-hbonds[1]: "O2'@A.U47[2.71]"
  16 A.G57           OP2-cap: "A.PSU55"
  17 A.1MA58         OP2-hbonds[1]: "N3@A.PSU55[2.77]"
  18 A.C60           OP1-hbonds[1]: "N4@A.C61[3.12]" OP2-hbonds[1]: "O2'@A.1MA58[2.42]"

****************************************************************************
This structure contains 1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ehz nts=76 [whole]
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
>1ehz-A #1 nts=76 [chain] RNA
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch)
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Note: shown above, the 3-dimensional schematic images (with rectangular base blocks) were created with the 3DNA blocview program to generate .r3d-formatted files that were ray-traced using PyMOL. The 2-dimensional diagrams were produced with VARNA: Visualization Applet for RNA using DSSR-derived base sequence and dot-bracket notation of secondary structure:
Code: [Select]
>1msy-A #1 RNA with 27 nts
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).

>1ehz-A #1 RNA with 76 nts
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGuPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

1174
Did you read the 3DNA NP08 paper? Pay special attention to recipe #1, Figure 2: "Schematic diagrams of three representative rigid-body parameters"), and recipe #2, Figure 3: "3DNA-generated images of 22-bp DNA duplexes with the same overall 45° curvature per helical turn".

Also, in 3DNA distribution, did you notice the directory $X3DNA/examples/calladine_drew? It contains further details (see the README file) on how to produce such schematics.

HTH,

Xiang-Jun

1175
General discussions (Q&As) / Re: DNA/ RNA fibre model values
« on: March 02, 2013, 12:01:34 pm »
Quote
I would like to known why in fibre models the values of tilt and shift has to be close to zero

The fiber models from 3DNA are based on experimental data, collected from various sources (for details, type "fiber -m"). You observed that in those structures, the values of tilt and shift are close to zero. Note that the fiber models are simplified, averaged, and regular structures. Compared to roll and slide, tilt and shift are normally not as significant in defining DNA or RNA duplex structures. For example, to a first approximation, A- and B-DNA are distinguished by slide and roll, as shown in Figure 4 of the 3DNA NAR03 paper.



To get a better understanding of DNA structures, see Calladine's book titled "Understanding DNA: The Molecule and How it Works".

HTH,

Xiang-Jun

Pages: 1 ... 45 46 [47] 48 49 ... 67

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University