Netiquette · Download · News · Gallery · Homepage · DSSR · Web-DSSR · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL

Author Topic: Superimpose representative cluster of a RNA strand after simulation  (Read 71 times)

Offline Sruthi0412

  • Verified Member
  • *
  • Posts: 3
    • View Profile
Dear all,

 I had a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' in which the CAUA region was changed to DC DA DT DA DNA bases. I ran some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand.
 Now I need to superimpose the major representative cluster of the modified RNA simulation with the original unmodified RNA strand to see the changes in interaction. Also the initial unmodified RNA strand interacts with a protein. After superimposition I want to see the change in nucleic acid- amino acid interactions as well.
 So I wanted to know if it is possible to this superimposition effectively using x3DNA.

Offline xiangjun

  • Administrator
  • Verified Member
  • *****
  • Posts: 1528
    • View Profile
    • 3DNA homepage
Re: Superimpose representative cluster of a RNA strand after simulation
« Reply #1 on: November 10, 2020, 06:55:08 pm »
Hi,

Please provide concrete examples to illustrate unambiguously what you what to achieve.

Best regards,

Xiang-Jun


PS. DSSR 2.x (paid version) contains built-in support for the analysis of MD simulations, and advanced features for DNA/RNA modeling. It can also be used to perform sequence-independent search/fitting employing base as well as backbone structures.
« Last Edit: November 10, 2020, 11:56:47 pm by xiangjun »
Dr. Xiang-Jun Lu [律祥俊]
Email: xiangjun@x3dna.org
Homepage: http://x3dna.org/
Forum: http://forum.x3dna.org/

* Click "NOTIFY" to receive email notifications
* Original Poster, please provide a summary
* DSSR 2.0 has superseded the 3DNA v2.4 suite

 

Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.