Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage · HIRING!

Author Topic: significance of character "P"  (Read 77377 times)

Offline laura savana

  • with-posts
  • *
  • Posts: 2
    • View Profile
significance of character "P"
« on: August 28, 2018, 08:39:01 am »
Hello, I am new of this forum.
First of all I want to congratulate with Dr. Xiang-Jun Lu for his software and his website: software is very easy to use and can give out many informations, website explains in details every software feature.
I like use DSSR, but I have a question about his output sequences. In some of them appear "P" character: what means? I don't succed to find the answer. P isn't reported in IUPAC nomenclature or in other websites which contain informations about nomenclature of RNA sequence.
I show below an example ("P" is indicated in bold):
GCCGAUAUAGCUCAGuuGGuAGAGCAGCGCAUUCGUaAUGCGAAGgUCGUAGGtPCGACUCCUAUUAUCGGCACCA&a

In this example there is also another doubt that I can't explain me: there is a "t" (before "P"). Is there a sort of connection between "t" and "P"? If not, why appears "t" (I suppose stands for timine) if it's a RNA sequence?

Thank you so much for availability.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1737
    • View Profile
    • 3DNA homepage
Re: significance of character "P"
« Reply #1 on: August 28, 2018, 11:26:33 am »
Hi,

Thanks for using DSSR and for posting your questions on the Forum. I appreciate your kind words about the DSSR program. I take DSSR as an example of what scientific software should/could be in my understanding. I will continuously do my best to extend and polish the program to make it a handy tool for the RNA structure community.

Now back to your question on what "P" means in DSSR output. The "3.2.1 Summary section" of the DSSR User Manual has the following note:

Quote
Note that pseudouridine, the most prevalent modified nt in RNA, is denoted ‘P’1 in DSSR since the small case ‘p’ is reserved for potential modified pseudouridines.

1Not to be confused with the phosphorus atom in the backbone phosphate group. In fact, the distinction should be clear in context.

I picked up "P" for pseudouridine specifically because it is not listed in the IUPAC nomenclature for nucleotide ambiguity code.

See also my blog posts "Modified pseudouridines" and "Definition of the chi (χ) torsion angle for pseudouridine"

The lower case "t" means modified T which can also exist in RNA structures. For example, the classic yeast phenylalanine tRNA (1ehz) has the T-loop named after a T base.

Also "tP" means t and P are directly connected, as in other cases. Otherwise, a "&" would be inserted, as also shown in your example.



As a side note, DSSR has far more features than a typical user may care. See the following note in the DSSR User Manual.

Quote
There is actually more to DSSR than meets the eye. To target the widest possible user base, I’ve deliberately omitted advanced/technical features in the manual (which is already over 90 pages). Moreover, many documented options have additional variations that may be of interests to some applications. If you feel that a relevant functionality should be there but missing from the manual, Simply ask on the 3DNA Forum.
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline laura savana

  • with-posts
  • *
  • Posts: 2
    • View Profile
Re: significance of character "P"
« Reply #2 on: August 28, 2018, 02:32:56 pm »
Thank you so much.
You cancelled my doubts.
I renew my congratulations also for the efficiency of this forum: you answer very quickly.
Thank you for all.

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University