Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.6.0 (DSSR Manual) · Homepage

Author Topic: construct dna hairpin structure  (Read 43508 times)

Offline atyagiaa

  • with-posts
  • *
  • Posts: 2
    • View Profile
construct dna hairpin structure
« on: September 04, 2017, 11:42:05 pm »
Hi,

I read the manual, and i am confused, how to start designing the hairpin structure for following sequence.
 
GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCTCCC
((((((((((((...)))))...........)))))))

 
But, I don't know from where to start, i read the manual and found it confusing to start it.

Please suggest tutorial, any help will be very helpful.

Thanks

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1705
    • View Profile
    • 3DNA homepage
Re: construct dna hairpin structure
« Reply #1 on: September 04, 2017, 11:57:52 pm »
Hi,

Sorry to know that you "read the manual and found it confusing to start" "designing the hairpin structure" of your sequence. That's not a surprise since 3DNA/DSSR is not a tool designed for such modeling purpose. You may find the RNA-Puzzles project relevant: some of the tools reported there should get you started. For example, try RNAComposer.

Best regards,

Xiang-Jun

Offline atyagiaa

  • with-posts
  • *
  • Posts: 2
    • View Profile
Re: construct dna hairpin structure
« Reply #2 on: September 05, 2017, 05:59:50 am »
Thankyou for the reply,

I used the server and obtained RNA structure, now I need to modify this structure to DNA, can 3DNA help me to perform this step.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1705
    • View Profile
    • 3DNA homepage
Re: construct dna hairpin structure
« Reply #3 on: September 05, 2017, 12:02:16 pm »
Thanks for your follow-up.

3DNA should be of help in modifying an RNA structure into its DNA variant. There are several possibilities here. Please use a concrete example to illustrate what you want to achieve.

Xiang-Jun

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University