Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.3 (DSSR Manual) · Homepage

Author Topic: issues in converting pdb to "dot bracket notation"  (Read 125150 times)

Offline bchetnani

  • with-posts
  • *
  • Posts: 2
    • View Profile
issues in converting pdb to "dot bracket notation"
« on: September 14, 2013, 09:17:54 pm »
Hello everyone
I have been trying to use DSSR to obtain a "dot bracket notation" for an RNA structure. The pdb I am using is 3Q1Q and its B chain has 347 nucleotides . The program however uses only 341 nts for chain B as input. The pdb does not have any modified nucleotides and there are no breaks. I am unable to figure out what might be the cause for this. Could you please let me know if it a bug or something I might be doing wrong.
Thank you
Bhaskar

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1742
    • View Profile
    • 3DNA homepage
Re: issues in converting pdb to "dot bracket notation"
« Reply #1 on: September 14, 2013, 11:18:50 pm »
Hi Bhaskar,

Thanks for using DSSR and posting your question(s) on the Forum. The issue you noticed with DSSR-generated "dot bracket notation" for PDB entry 3q1q is as expected in its current implementation.
>3q1q-B #1 RNA* with 341 nts, in order
GGAGAGGAGCAGGCGGUCGCGGGGGCGCACACCUGCGCUCCCGAGGAAAGUCCGGACUCUGGAGCGGGGUGCCGGGUAACGCCCGGGAGGGGUGACCCUCGGACAGGGCCAUAGAGAAGAAGACCGCCCGGGGGGAAACUUCCGGGCAAGGGUGGAACGGUGGGGUAAGAGCCCACCAGCGUCGGGGCAACCCGGCGGCUUGGCAACCCCCACCUGGAGCAAGGCCAAGCAGGGGGUUGGGUCGCUCCCCUAUUCCCCCGGGUUGGCCGCUUGAGGUGUGCGGUAACGCACACCCCAGAUUGAUGACCGCCACAGAAUCCGGCUUAUGCUCCUCUCCCGUG
((((((((((..((((((.((((.(((((....))))).)))).(...((.((((((((([[[[[.((((((((((.....)))))(((((....)))))((...(((((.............(((((((((((....)))))))))..)).......((((((.......))))))(.(((((((....)))))))..).)))..)))))))))))))...[[[[.....{{{{...<<<..]]]]]>>>....}}}}.(((.]]]]......((((((((....))))))))..........))))))..)....)))))))...))))))))))....
>3q1q-C #2 RNA* with 82 nts, in order
GGCCAGGUAGCUCAGGGAGAGCACUGGAUAUGGGCACCCCCUAAGUCCAGGUGCGGCGGUUCGAUUCCGCCCCUGGCCACCA
(((((((..((((...[.)))).((((((..(((....)))...))))))....(((((..]....))))))))))))))).

Note the *s highlighted above, which signify breaks of nucleobases in the input structure. In DSSR, as in 3DNA, nucleotides are derived from base rings atoms in the PDB or PDBx/mmCIF file. As can be seen below, residue B.U39 in 3q1q has only ATOM records for the backbone (in red), but none for the base. You may want to check for yourself other such cases to account for the inconsistency in number of nts for chains B and C.
ATOM    810  P     C B  38      27.276 -44.145   9.394  1.00 80.00           P  
ATOM    811  OP1   C B  38      26.183 -43.184   9.115  1.00 80.00           O 
ATOM    812  OP2   C B  38      28.673 -43.648   9.404  1.00 80.00           O 
ATOM    813  O5'   C B  38      27.008 -44.858  10.808  1.00 80.00           O 
ATOM    814  C5'   C B  38      25.731 -45.392  11.179  1.00 80.00           C 
ATOM    815  C4'   C B  38      25.723 -45.968  12.591  1.00 80.00           C 
ATOM    816  O4'   C B  38      26.785 -46.947  12.768  1.00 80.00           O 
ATOM    817  C3'   C B  38      25.856 -44.974  13.744  1.00 80.00           C 
ATOM    818  O3'   C B  38      24.919 -45.259  14.795  1.00 80.00           O 
ATOM    819  C2'   C B  38      27.306 -45.149  14.194  1.00 80.00           C 
ATOM    820  O2'   C B  38      27.521 -44.843  15.559  1.00 80.00           O 
ATOM    821  C1'   C B  38      27.517 -46.640  13.943  1.00 80.00           C 
ATOM    822  N1    C B  38      28.967 -47.060  13.807  1.00 80.00           N 
ATOM    823  C2    C B  38      29.617 -47.732  14.873  1.00 80.00           C 
ATOM    824  O2    C B  38      29.007 -48.011  15.918  1.00 80.00           O 
ATOM    825  N3    C B  38      30.930 -48.076  14.726  1.00 80.00           N 
ATOM    826  C4    C B  38      31.592 -47.774  13.597  1.00 80.00           C 
ATOM    827  N4    C B  38      32.876 -48.136  13.507  1.00 80.00           N 
ATOM    828  C5    C B  38      30.960 -47.089  12.509  1.00 80.00           C 
ATOM    829  C6    C B  38      29.668 -46.754  12.659  1.00 80.00           C 
ATOM    830  P     U B  39      24.284 -44.122  15.737  1.00 80.00           P 
ATOM    831  OP1   U B  39      22.814 -44.315  15.717  1.00 80.00           O 
ATOM    832  OP2   U B  39      24.834 -42.793  15.370  1.00 80.00           O 
ATOM    833  O5'   U B  39      24.871 -44.473  17.192  1.00 80.00           O 
ATOM    834  C5'   U B  39      24.438 -45.584  17.981  1.00 80.00           C 
ATOM    835  C4'   U B  39      23.332 -45.180  18.944  1.00 80.00           C 
ATOM    836  C3'   U B  39      23.784 -44.467  20.213  1.00 80.00           C 
ATOM    837  O3'   U B  39      23.540 -43.056  20.125  1.00 80.00           O 

ATOM    838  P     U B  40      24.587 -41.959  20.658  1.00 80.00           P 
ATOM    839  OP1   U B  40      24.649 -42.089  22.135  1.00 80.00           O 
ATOM    840  OP2   U B  40      24.206 -40.655  20.068  1.00 80.00           O 
ATOM    841  O5'   U B  40      25.982 -42.393  19.987  1.00 80.00           O 
ATOM    842  C5'   U B  40      27.208 -42.521  20.704  1.00 80.00           C 
ATOM    843  C4'   U B  40      27.371 -43.944  21.208  1.00 80.00           C 
ATOM    844  O4'   U B  40      27.451 -44.862  20.086  1.00 80.00           O 
ATOM    845  C3'   U B  40      28.594 -44.204  22.075  1.00 80.00           C 
ATOM    846  O3'   U B  40      28.264 -44.010  23.462  1.00 80.00           O 
ATOM    847  C2'   U B  40      28.934 -45.657  21.747  1.00 80.00           C 
ATOM    848  O2'   U B  40      28.276 -46.605  22.568  1.00 80.00           O 
ATOM    849  C1'   U B  40      28.488 -45.807  20.289  1.00 80.00           C 
ATOM    850  N1    U B  40      29.577 -45.683  19.217  1.00 80.00           N 
ATOM    851  C2    U B  40      30.695 -46.550  19.196  1.00 80.00           C 
ATOM    852  O2    U B  40      30.963 -47.437  19.996  1.00 80.00           O 
ATOM    853  N3    U B  40      31.627 -46.340  18.195  1.00 80.00           N 
ATOM    854  C4    U B  40      31.522 -45.386  17.189  1.00 80.00           C 
ATOM    855  O4    U B  40      32.377 -45.290  16.317  1.00 80.00           O 
ATOM    856  C5    U B  40      30.350 -44.542  17.249  1.00 80.00           C 
ATOM    857  C6    U B  40      29.446 -44.715  18.228  1.00 80.00           C 

HTH,

Xiang-Jun
« Last Edit: September 14, 2013, 11:36:22 pm by xiangjun »
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline bchetnani

  • with-posts
  • *
  • Posts: 2
    • View Profile
Re: issues in converting pdb to "dot bracket notation"
« Reply #2 on: September 14, 2013, 11:30:19 pm »
Thank you Dr. Lu

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University