2
« on: August 28, 2018, 08:39:01 am »
Hello, I am new of this forum.
First of all I want to congratulate with Dr. Xiang-Jun Lu for his software and his website: software is very easy to use and can give out many informations, website explains in details every software feature.
I like use DSSR, but I have a question about his output sequences. In some of them appear "P" character: what means? I don't succed to find the answer. P isn't reported in IUPAC nomenclature or in other websites which contain informations about nomenclature of RNA sequence.
I show below an example ("P" is indicated in bold):
GCCGAUAUAGCUCAGuuGGuAGAGCAGCGCAUUCGUaAUGCGAAGgUCGUAGGtPCGACUCCUAUUAUCGGCACCA&a
In this example there is also another doubt that I can't explain me: there is a "t" (before "P"). Is there a sort of connection between "t" and "P"? If not, why appears "t" (I suppose stands for timine) if it's a RNA sequence?
Thank you so much for availability.