Show Posts
1
General discussions (Q&As) / I want to find PDB file
« on: March 14, 2015, 06:55:12 am »
Dear developer..
Today, I installed DSSR and 3DNA
I want analysis Secondary structure of DNA.
I read the User Manual for DSSR. For using DSSR, PDB file should be prepared.
However, in my case, there are no PDB files, since I used artificial DNA strands. Then, how to fabricate PDB flies (secondary structure of DNA).
Is there any software of web based tools? (I searched Molecular dynamics things.... but I can't find suitable software.)
I want to know one of the secondary structure of sequence "GCGAGCAGACTCCGGTGGAATGAAGGACTCGCAGG CTG ATT CGG TTC ATG CGG ATC CA".
but I couldn't make PDB file.
There are 2D secondary structure builders like mfold, RNA structure, But it cannot be used in x3dna or DSSR
Would you tell me how I find or make the PDB files ?
Today, I installed DSSR and 3DNA
I want analysis Secondary structure of DNA.
I read the User Manual for DSSR. For using DSSR, PDB file should be prepared.
However, in my case, there are no PDB files, since I used artificial DNA strands. Then, how to fabricate PDB flies (secondary structure of DNA).
Is there any software of web based tools? (I searched Molecular dynamics things.... but I can't find suitable software.)
I want to know one of the secondary structure of sequence "GCGAGCAGACTCCGGTGGAATGAAGGACTCGCAGG CTG ATT CGG TTC ATG CGG ATC CA".
but I couldn't make PDB file.
There are 2D secondary structure builders like mfold, RNA structure, But it cannot be used in x3dna or DSSR
Would you tell me how I find or make the PDB files ?