Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Messages - tnwl124

Pages: [1]
1
General discussions (Q&As) / I want to find PDB file
« on: March 14, 2015, 06:55:12 am »
Dear developer..

Today, I installed DSSR and 3DNA

I want analysis Secondary structure of DNA.

I read the User Manual for DSSR. For using DSSR, PDB file should be prepared.

However, in my case, there are no PDB files, since I used artificial DNA strands. Then, how to fabricate PDB flies (secondary structure of DNA).

Is there any software of web based tools? (I searched Molecular dynamics things.... but I can't find suitable software.)
I want to know one of the secondary structure of sequence "GCGAGCAGACTCCGGTGGAATGAAGGACTCGCAGG CTG ATT CGG TTC ATG CGG ATC CA".

but I couldn't make PDB file.
There are 2D secondary structure builders like mfold, RNA structure, But it cannot be used in x3dna or DSSR

Would you tell me how I find or make the PDB files ?

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University