Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers
Questions and answers > RNA structures (DSSR)
A pair is absent in dot-bracket notation ?
(1/1)
sk:
Hello,
when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.
Here is a copy of the output.
--- Code: --- DSSR: an Integrated Software Tool for
Dissecting the Spatial Structure of RNA
v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.G1 A.C21 G-C WC 19-XIX cWW cW-W
2 A.G2 A.C20 G-C WC 19-XIX cWW cW-W
3 A.C3 A.G19 C-G WC 19-XIX cWW cW-W
4 A.G4 A.U18 G-U Wobble 28-XXVIII cWW cW-W
5 A.U5 A.A17 U-A WC 20-XX cWW cW-W
6 A.A7 A.U16 A-U -- -- cWW cW-W
7 A.G8 A.C15 G-C WC 19-XIX cWW cW-W
8 A.G9 A.C14 G-C WC 19-XIX cWW cW-W
****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))
****************************************************************************
--- End code ---
sk:
Ok, I think I understood now.
in dbn we have only Watson-Crick and wobble G–U pairs.
Thanks:)
xiangjun:
Hi,
Thanks for using DSSR, and for asking questions with specifics and for your followup.
6 A.A7 A.U16 A-U -- -- cWW cW-W
Base-pair #6 is Watson-Crick like, but not a WC A-U pair, due to unconventional H-bonding patterns, as detailed below:
[-153.4(anti) ~C3'-endo lambda=53.9] [-160.2(anti) ~C3'-endo lambda=88.0]
d(C1'-C1')=10.02 d(N1-N9)=9.09 d(C6-C8)=10.56 tor(C1'-N1-N9-C1')=-7.1
H-bonds[1]: "N1*O2(carbonyl)[2.91]"
interBase-angle=12 Simple-bpParams: Shear=-2.57 Stretch=1.35 Buckle=9.9 Propeller=-7.0
bp-pars: [-2.83 0.63 0.93 11.39 -4.17 30.82]
The DBN notation is for classic 2nd stratucure with WC and G-U wobble pairs.
Best regards,
Xiang-Jun
Navigation
[0] Message Index
Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.