Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers
DSSR: an Integrated Software Tool for
Dissecting the Spatial Structure of RNA
v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.G1 A.C21 G-C WC 19-XIX cWW cW-W
2 A.G2 A.C20 G-C WC 19-XIX cWW cW-W
3 A.C3 A.G19 C-G WC 19-XIX cWW cW-W
4 A.G4 A.U18 G-U Wobble 28-XXVIII cWW cW-W
5 A.U5 A.A17 U-A WC 20-XX cWW cW-W
6 A.A7 A.U16 A-U -- -- cWW cW-W
7 A.G8 A.C15 G-C WC 19-XIX cWW cW-W
8 A.G9 A.C14 G-C WC 19-XIX cWW cW-W
****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))
****************************************************************************
Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.