Netiquette · Download · News · Gallery · Homepage · DSSR · Web-DSSR · DSSR Manual · Reproduce DSSR · DSSR-Jmol · DSSR-PyMOL · Web-SNAP

Recent Posts

Pages: 1 2 [3] 4 5 ... 10
21
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by xiangjun on January 15, 2018, 10:35:21 am »
Hi Isaure,

Thanks for using DSSR and for posting your message on the 3DNA Forum.

Running DSSR on PDB entry 4oo8, I got the following:

Code: [Select]
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4oo8 nts=236 [whole]
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&CAGCCAAGCGCACCTAATTTCC
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))&((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&..))))))))))))))))))))
>4oo8-B #1 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4oo8-C #2 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
>4oo8-E #3 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4oo8-F #4 nts=22 2.61(1.34) [chain] DNA
CAGCCAAGCGCACCTAATTTCC
..))))))))))))))))))))

Could you please provide details on how you ran DSSR command-line on it to get the output you reported?

Best regards,

Xiang-Jun
22
RNA structures (DSSR) / brackets in DNA-RNA pairing
« Last post by ICdB on January 15, 2018, 10:19:45 am »
Hi,

I ran dssr locally on PDB 4OO8, which contains 2 symmetrical copies of a RNA-DNA duplex, made of chains E-F and B-C. The only difference in the 2 duplexes is 3 additional bases in 5' of the DNA chain.
However, the secondary structure given for each duplex is different:

for DNA - RNA:
chain_C['sstr'], chain_B['sstr'] =  '[[[[[[[[[[[[[[[[[[[[',  ']]]]]]]]]]]]]]]]]]]]'
chain_F['sstr'], chain_E['sstr'] = '((((((((((((((((((((' , '))))))))))))))))))))'

When running dssr on http://jmol.x3dna.org/, the secondary structure is identical for the 2 duplexes (with round brackets).
So what is the meaning of the squared brackets in the local version?

Thanks in advance,
Isaure
23
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by sli on January 14, 2018, 07:40:37 am »
Thanks for your help and your suggestions!
24
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by xiangjun on January 07, 2018, 11:11:01 am »
Hi,

Thanks for providing an attachment detailing the procedures you used to generate the above image. Discussions based on concrete examples are (far) more likely to achieve meaning results (in my experience, at least).

As a side note (for you and other viewers of the thread), it would have be more convenient for reference and discussion if the step-by-step procedures were directly listed (in plain text where possible) within your post. Images etc. can be attached separately, and referenced in the post. If one composite attachment is needed, PDF format is preferred.


Now let's return to the main topic on the rigor of the 3DNA analyze/rebuild cycle. You used PyMOL "pair_fit" to compare your original vs 3DNA-generated coordinates and noticed differences. The result is expected since your PyMOL selections used sugar atoms, but not I intended in the original response.

As noted in the two major 3DNA publications (2003 NAR, and 2008 Nature Protocols), the 3DNA analyze/rebuild routines are rigorously reversible for base (pair) geometries only. The sugar and phosphate backbone have many more conformational flexibility than can be captured by the base-pair parameters (e.g., in file bp_step.par you referred to in your attachment).

The intended procedure is described below, using your original my.pdb as an example.

Code: Bash
  1. # create a new directory, here I call it 'check-3dna'
  2. mkdir check-3dna
  3. cd check-3dna
  4.  
  5. # copy your original coordinate 'my.pdb' into it
  6. cp ~/Downloads/my.pdb .
  7.  
  8. # The following step creates file 'bp_step.par' with 27 base pairs
  9. #   which does not include the flipped out 'base pair'
  10. find_pair my.pdb | analyze
  11.  
  12. # Copy 'bp_step.par' to a different name for later reference and
  13. #   to avoid being over-written
  14. cp bp_step.par bp_step-01.par
  15.  
  16. # Rebuild the structure with base atoms, using 'bp_step.par'
  17. rebuild -atomic bp_step-01.par my-3DNA-noFlippedBP.pdb
  18.  
  19. # The 3DNA-rebuilt structure 'my-3DNA-noFlippedBP.pdb' has virtually
  20. #   the same base geometry as that in your original 'my.pdb'
  21. # You could perform a least-square fit between them, and the RMSD
  22. #   should be ~0.05 A, as reported in Table 3 of the 2003 NAR paper
  23.  
  24. # Another way, which is more convenient, is to re-analyze the generated structure
  25. #   and you should get virtually the same base-pair parameters.
  26. #   Compare files: bp_step-01.par and bp_step-02.par
  27. find_pair my-3DNA-noFlippedBP.pdb | analyze
  28. cp bp_step.par bp_step-02.par

Content of bp_step-01.par derived by 3DNA from my.pdb:
Code: [Select]
  27 # base-pairs
   0 # ***local base-pair & step parameters***
#        Shear    Stretch   Stagger   Buckle   Prop-Tw   Opening     Shift     Slide     Rise      Tilt      Roll      Twist
C-G      0.024    -0.090     0.005     6.772   -10.617    -5.789     0.000     0.000     0.000     0.000     0.000     0.000
A-T     -0.235    -0.122     0.109     7.664    -9.878     4.793     0.858     0.172     3.336     2.918     1.014    36.431
G-C     -0.314    -0.136     0.169     6.500    -9.562    -0.082    -0.285    -0.085     3.345    -3.583     4.594    32.884
C-G      0.908    -0.373     0.361    -2.969   -14.984     0.844    -0.033    -0.543     3.503    -1.181     1.058    40.091
T-A      0.141    -0.106    -0.007     0.613   -11.986    -0.729    -0.262    -0.322     3.111     4.851     5.221    31.076
C-G     -0.128    -0.143    -0.018    -6.366    -7.366    -1.917     0.166    -0.074     3.344     0.674     3.320    38.090
T-A     -0.267    -0.086    -0.045    -2.563    -8.559    -4.240    -0.195     0.042     3.225     0.735     3.922    31.086
G-C     -0.292    -0.166     0.077    -2.822    -6.954    -0.544     0.321     0.426     3.290    -1.721     6.687    39.395
T-A     -0.116    -0.100     0.123    -0.937    -8.673     1.568    -0.192    -0.485     3.262    -0.351     3.766    27.420
A-T     -0.001    -0.140     0.182     5.758   -11.903     3.559    -0.055     0.800     3.198    -1.188     3.163    38.313
C-G      0.116    -0.132    -0.304    10.768   -15.829     1.506    -0.045     0.140     3.165     4.626    -3.320    33.025
T-A     -0.258    -0.054     0.114   -11.001   -15.078    -1.647    -2.308     1.316     8.892    -4.317    41.393    38.812
G-C     -0.088    -0.073    -0.133     0.310   -10.536     1.897     0.382     1.086     3.191    -0.110     8.307    34.361
A-T      0.447    -0.165     0.016    -0.099    -7.962     0.665    -0.652    -0.040     3.312    -5.166     3.761    35.830
G-C     -0.139    -0.145     0.207     6.023    -6.516    -2.554    -1.012     0.163     3.163    -3.561     3.126    34.190
C-G      0.295    -0.232     0.091     1.023   -11.858    -3.258    -0.124    -0.238     3.404     0.838     1.644    37.078
G-C     -0.374    -0.240    -0.110    -2.127   -16.386    -0.188     0.321     0.355     3.350     1.347    12.377    33.332
A-T     -0.017    -0.100    -0.202    -8.205   -12.579     0.613    -0.320     0.038     3.344    -2.364     3.451    38.627
T-A     -0.045    -0.112    -0.018    -3.031   -13.642     2.107    -0.323    -0.547     3.153    -0.891     1.361    28.238
G-C     -0.143    -0.224    -0.025    -0.009    -4.949    -0.572     0.835     1.066     3.262     2.167     4.308    36.515
G-C     -0.264    -0.139    -0.194    -2.023   -13.899     0.810    -1.167     0.841     3.376    -1.701     4.690    34.890
A-T      0.040    -0.101    -0.032    -2.595   -10.719    -3.810    -0.326     0.031     3.276    -2.461     2.045    38.245
C-G      0.195    -0.173    -0.010     2.489    -4.509    -3.218     0.899    -0.332     3.198    -0.443     1.198    31.804
A-T     -0.073    -0.062    -0.077     6.348   -10.043    -1.996    -0.323     0.717     3.324     2.003     5.002    35.639
G-C     -0.138    -0.095     0.097     5.909   -11.083    -2.265    -0.457    -0.121     3.331    -4.406     6.090    32.917
C-G      0.665    -0.218     0.076     2.871   -13.498     1.620     0.153    -0.549     3.373    -0.247     1.964    34.405
T-A     -0.224    -0.042     0.232    -0.691   -16.719     5.480     0.498    -0.227     3.326     3.538     6.708    26.031

Content of bp_step-02.par derived by 3DNA from my-3DNA-noFlippedBP.pdb:
Code: [Select]
  27 # base-pairs
   0 # ***local base-pair & step parameters***
#        Shear    Stretch   Stagger   Buckle   Prop-Tw   Opening     Shift     Slide     Rise      Tilt      Roll      Twist
C-G      0.024    -0.090     0.006     6.763   -10.628    -5.790     0.000     0.000     0.000     0.000     0.000     0.000
A-T     -0.235    -0.122     0.109     7.661    -9.872     4.801     0.858     0.172     3.336     2.922     1.020    36.430
G-C     -0.314    -0.136     0.169     6.511    -9.550    -0.079    -0.285    -0.085     3.345    -3.590     4.592    32.886
C-G      0.908    -0.373     0.361    -2.975   -14.974     0.851    -0.033    -0.543     3.503    -1.180     1.059    40.091
T-A      0.141    -0.106    -0.006     0.603   -11.983    -0.723    -0.262    -0.322     3.111     4.846     5.214    31.074
C-G     -0.128    -0.143    -0.018    -6.369    -7.377    -1.911     0.166    -0.074     3.344     0.676     3.325    38.095
T-A     -0.268    -0.086    -0.046    -2.559    -8.549    -4.249    -0.196     0.042     3.225     0.737     3.921    31.075
G-C     -0.292    -0.166     0.076    -2.830    -6.962    -0.538     0.321     0.426     3.290    -1.721     6.686    39.402
T-A     -0.116    -0.100     0.123    -0.939    -8.667     1.569    -0.192    -0.485     3.262    -0.357     3.767    27.419
A-T     -0.001    -0.140     0.183     5.764   -11.901     3.557    -0.055     0.800     3.198    -1.187     3.155    38.314
C-G      0.116    -0.132    -0.304    10.769   -15.820     1.512    -0.045     0.140     3.165     4.632    -3.314    33.027
T-A     -0.258    -0.054     0.114   -11.005   -15.065    -1.643    -2.308     1.316     8.892    -4.314    41.391    38.806
G-C     -0.088    -0.073    -0.134     0.300   -10.540     1.897     0.382     1.086     3.191    -0.111     8.319    34.364
A-T      0.447    -0.165     0.015    -0.095    -7.959     0.665    -0.652    -0.040     3.312    -5.162     3.752    35.826
G-C     -0.139    -0.145     0.206     6.020    -6.517    -2.559    -1.012     0.163     3.163    -3.560     3.139    34.196
C-G      0.295    -0.232     0.091     1.007   -11.864    -3.258    -0.124    -0.238     3.404     0.830     1.641    37.074
G-C     -0.374    -0.240    -0.111    -2.125   -16.385    -0.191     0.321     0.355     3.350     1.349    12.387    33.330
A-T     -0.017    -0.100    -0.202    -8.203   -12.574     0.613    -0.320     0.038     3.344    -2.371     3.443    38.630
T-A     -0.045    -0.112    -0.018    -3.029   -13.634     2.111    -0.323    -0.547     3.153    -0.892     1.357    28.236
G-C     -0.143    -0.224    -0.024    -0.001    -4.957    -0.560     0.835     1.066     3.262     2.168     4.306    36.516
G-C     -0.264    -0.139    -0.193    -2.012   -13.908     0.815    -1.167     0.841     3.376    -1.700     4.690    34.890
A-T      0.040    -0.101    -0.033    -2.618   -10.725    -3.809    -0.326     0.031     3.277    -2.455     2.045    38.244
C-G      0.195    -0.173    -0.010     2.488    -4.495    -3.214     0.899    -0.332     3.197    -0.450     1.201    31.803
A-T     -0.073    -0.062    -0.078     6.342   -10.052    -1.990    -0.323     0.717     3.324     2.009     4.999    35.641
G-C     -0.138    -0.095     0.097     5.907   -11.081    -2.258    -0.457    -0.121     3.331    -4.412     6.094    32.917
C-G      0.665    -0.218     0.076     2.876   -13.506     1.621     0.153    -0.549     3.373    -0.252     1.962    34.406
T-A     -0.224    -0.042     0.233    -0.695   -16.735     5.492     0.498    -0.227     3.326     3.539     6.702    26.033

For your verification, I've attached the following four files:

  • my.pdb -- your original coordinate file
  • bp_step-01.par -- base-pair parameters used for rebuilding
  • my-3DNA-noFlippedBP.pdb -- 3DNA-generated structure based on bp_step-01.par
  • bp_step-02.par -- base-pair parameters from 3DNA-generated structure

Please repeat the above procedure with the flipped base-pair included, and report back your findings. I'll be happy to help if necessary.

Best regards,

Xiang-Jun
25
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by sli on January 07, 2018, 07:37:30 am »
Dear Dr. Lu,

         I am sorry I have not reply you on time. The above image generation process can be obtained from my attached file.

Best wishes!
26
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by xiangjun on January 03, 2018, 10:59:04 am »
Hi,

Thanks for your followup. I sort of understand your confusions in general. Your case could serve as an excellent example to clarify some subtle points in 3DNA. To proceed, could you please provide details what you did, especially how you generate the attached image?

Best regards,

Xiang-Jun
27
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by sli on January 03, 2018, 02:29:58 am »
Thank you very much! I add a line as following:
    2         # duplex
   28         # number of base-pairs
    1     1    # explicit bp numbering/hetero atoms
  198   253   0 #    1 | ....>C:...1_:[.DC]C-----G[.DG]:..28_:D<....   0.09   0.00  12.58   9.13  -4.27
  199   252   0 #    2 | ....>C:...2_:[.DA]A-----T[.DT]:..27_:D<....   0.29   0.11  12.49   8.76  -3.87
  200   251   0 #    3 | ....>C:...3_:[.DG]G-----C[.DC]:..26_:D<....   0.38   0.17  11.55   8.98  -3.71
  201   250   0 #    4 | ....>C:...4_:[.DC]C-----G[.DG]:..25_:D<....   1.05   0.36  15.27   8.77  -2.47
  202   249   0 #    5 | ....>C:...5_:[.DT]T-----A[.DA]:..24_:D<....   0.18   0.01  12.00   8.93  -4.21
  203   248   0 #    6 | ....>C:...6_:[.DC]C-----G[.DG]:..23_:D<....   0.19   0.02   9.73   9.01  -4.29
  204   247   0 #    7 | ....>C:...7_:[.DT]T-----A[.DA]:..22_:D<....   0.28   0.04   8.95   9.03  -4.18
  205   246   0 #    8 | ....>C:...8_:[.DG]G-----C[.DC]:..21_:D<....   0.34   0.08   7.51   8.96  -4.12
  206   245   0 #    9 | ....>C:...9_:[.DT]T-----A[.DA]:..20_:D<....   0.20   0.12   8.73   8.88  -4.12
  207   244   0 #   10 | ....>C:..10_:[.DA]A-----T[.DT]:..19_:D<....   0.23   0.18  13.22   8.78  -3.75
  208   243   9 #   11 x ....>C:..11_:[.DC]C-----G[.DG]:..18_:D<....   0.35   0.30  19.14   8.92  -3.08
  209   242   0 #   12 | ....>C:..12_:[.DG]G-----UF2[.DUF2]:..17_:D<....
  210   241   0 #   13 | ....>C:..13_:[.DT]T-----A[.DA]:..16_:D<....   0.29   0.11  18.66   8.94  -3.55
  211   240   0 #   14 | ....>C:..14_:[.DG]G-----C[.DC]:..15_:D<....   0.18   0.13  10.54   9.00  -4.03
  212   239   0 #   15 | ....>C:..15_:[.DA]A-----T[.DT]:..14_:D<....   0.48   0.02   7.98   8.84  -4.09
  213   238   0 #   16 | ....>C:..16_:[.DG]G-----C[.DC]:..13_:D<....   0.29   0.21   8.86   9.02  -3.85
  214   237   0 #   17 | ....>C:..17_:[.DC]C-----G[.DG]:..12_:D<....   0.39   0.09  11.91   8.95  -3.84
  215   236   0 #   18 | ....>C:..18_:[.DG]G-----C[.DC]:..11_:D<....   0.46   0.11  16.51   8.89  -3.50
  216   235   0 #   19 | ....>C:..19_:[.DA]A-----T[.DT]:..10_:D<....   0.23   0.20  15.04   8.89  -3.62
  217   234   0 #   20 | ....>C:..20_:[.DT]T-----A[.DA]:...9_:D<....   0.12   0.02  13.95   8.86  -4.15
  218   233   0 #   21 | ....>C:..21_:[.DG]G-----C[.DC]:...8_:D<....   0.27   0.03   4.95   8.88  -4.43
  219   232   0 #   22 | ....>C:..22_:[.DG]G-----C[.DC]:...7_:D<....   0.36   0.19  14.07   8.97  -3.55
  220   231   0 #   23 | ....>C:..23_:[.DA]A-----T[.DT]:...6_:D<....   0.11   0.03  11.03   9.00  -4.27
  221   230   0 #   24 | ....>C:..24_:[.DC]C-----G[.DG]:...5_:D<....   0.26   0.01   5.16   9.01  -4.46
  222   229   0 #   25 | ....>C:..25_:[.DA]A-----T[.DT]:...4_:D<....   0.12   0.08  11.88   8.99  -4.13
  223   228   0 #   26 | ....>C:..26_:[.DG]G-----C[.DC]:...3_:D<....   0.19   0.10  12.55   9.07  -3.98
  224   227   0 #   27 | ....>C:..27_:[.DC]C-----G[.DG]:...2_:D<....   0.70   0.08  13.79   8.87  -3.45
  225   226   0 #   28 | ....>C:..28_:[.DT]T-----A[.DA]:...1_:D<....   0.32   0.23  16.73   8.85  -3.38
##### Base-pair criteria used:     4.00     0.00    15.00     2.50    65.00     4.50     7.80 [ O N]
##### 0 non-Watson-Crick base-pairs, and 2 helices (0 isolated bps)
##### Helix #1 (11): 1 - 11
##### Helix #2 (16): 12 - 27

I found that on the line I added, the result of the output file(be_step.par) was the same whether I add the number(like as 0.30   0.35  18.14   9.92  -3.33 ) or not. and then I use the modified file(my.bps) to "analyze" and finally "rebuild" DNA structure.In addition, I align the original DNA structure and the rebuild DNA structure by Pymol(pair_fit) ,they are not completely same. So I am not sure that my rebuild structure is right. Because I can not well understand means of your words:"Nevertheless, they can be used to rigorously "rebuild" the original base geometry". Is it said that the rebuild structure should completely as the original one? The aligned result is shown in the attachment.

Best wishes!


 
28
FAQs / Re: How to fix missing (superfluous) base pairs identified by find_pair?
« Last post by xiangjun on January 02, 2018, 10:33:09 am »
In your my.pdb structure, the DNA nucleotide D.UF2/17 is flipped out of the duplex, instead of forming a pair with C.DG12. In such cases, you could proceed as noted in the FAQ:

Quote
In addition to (or instead of) manipulating parameters in misc_3dna.par, oftentimes it may be preferable to manually edit find_pair-generated base-piar files before feeding them into analyze/cehs. This allows for maximum flexibility as to which pair to consider in calculating 3DNA structural parameters.

So you could manually edit the find_pair output: changing 27 to 28, and add an extra line "209 242" as highlighted in red below. Note that in such cases, the step parameters (such as slide/roll etc) may not make intuitive sense (the numbers look weird). Nevertheless, they can be used to rigorously "rebuild" the original base geometry. See the 2008 3DNA Nature Protocols paper for more info.

my.pdb
my.out
    2         # duplex
   28         # number of base-pairs
    1     1    # explicit bp numbering/hetero atoms
  198   253   0 #    1 | ....>C:...1_:[.DC]C-----G[.DG]:..28_:D<....   0.09   0.00  12.58   9.13  -4.27
  199   252   0 #    2 | ....>C:...2_:[.DA]A-----T[.DT]:..27_:D<....   0.29   0.11  12.49   8.76  -3.87
  200   251   0 #    3 | ....>C:...3_:[.DG]G-----C[.DC]:..26_:D<....   0.38   0.17  11.55   8.98  -3.71
  201   250   0 #    4 | ....>C:...4_:[.DC]C-----G[.DG]:..25_:D<....   1.05   0.36  15.27   8.77  -2.47
  202   249   0 #    5 | ....>C:...5_:[.DT]T-----A[.DA]:..24_:D<....   0.18   0.01  12.00   8.93  -4.21
  203   248   0 #    6 | ....>C:...6_:[.DC]C-----G[.DG]:..23_:D<....   0.19   0.02   9.73   9.01  -4.29
  204   247   0 #    7 | ....>C:...7_:[.DT]T-----A[.DA]:..22_:D<....   0.28   0.04   8.95   9.03  -4.18
  205   246   0 #    8 | ....>C:...8_:[.DG]G-----C[.DC]:..21_:D<....   0.34   0.08   7.51   8.96  -4.12
  206   245   0 #    9 | ....>C:...9_:[.DT]T-----A[.DA]:..20_:D<....   0.20   0.12   8.73   8.88  -4.12
  207   244   0 #   10 | ....>C:..10_:[.DA]A-----T[.DT]:..19_:D<....   0.23   0.18  13.22   8.78  -3.75
  208   243   0 #   11 x ....>C:..11_:[.DC]C-----G[.DG]:..18_:D<....   0.35   0.30  19.14   8.92  -3.08
  209   242   0
  210   241   0 #   12 | ....>C:..13_:[.DT]T-----A[.DA]:..16_:D<....   0.29   0.11  18.66   8.94  -3.55

  211   240   0 #   13 | ....>C:..14_:[.DG]G-----C[.DC]:..15_:D<....   0.18   0.13  10.54   9.00  -4.03
  212   239   0 #   14 | ....>C:..15_:[.DA]A-----T[.DT]:..14_:D<....   0.48   0.02   7.98   8.84  -4.09
  213   238   0 #   15 | ....>C:..16_:[.DG]G-----C[.DC]:..13_:D<....   0.29   0.21   8.86   9.02  -3.85
  214   237   0 #   16 | ....>C:..17_:[.DC]C-----G[.DG]:..12_:D<....   0.39   0.09  11.91   8.95  -3.84
  215   236   0 #   17 | ....>C:..18_:[.DG]G-----C[.DC]:..11_:D<....   0.46   0.11  16.51   8.89  -3.50
  216   235   0 #   18 | ....>C:..19_:[.DA]A-----T[.DT]:..10_:D<....   0.23   0.20  15.04   8.89  -3.62
  217   234   0 #   19 | ....>C:..20_:[.DT]T-----A[.DA]:...9_:D<....   0.12   0.02  13.95   8.86  -4.15
  218   233   0 #   20 | ....>C:..21_:[.DG]G-----C[.DC]:...8_:D<....   0.27   0.03   4.95   8.88  -4.43
  219   232   0 #   21 | ....>C:..22_:[.DG]G-----C[.DC]:...7_:D<....   0.36   0.19  14.07   8.97  -3.55
  220   231   0 #   22 | ....>C:..23_:[.DA]A-----T[.DT]:...6_:D<....   0.11   0.03  11.03   9.00  -4.27
  221   230   0 #   23 | ....>C:..24_:[.DC]C-----G[.DG]:...5_:D<....   0.26   0.01   5.16   9.01  -4.46
  222   229   0 #   24 | ....>C:..25_:[.DA]A-----T[.DT]:...4_:D<....   0.12   0.08  11.88   8.99  -4.13
  223   228   0 #   25 | ....>C:..26_:[.DG]G-----C[.DC]:...3_:D<....   0.19   0.10  12.55   9.07  -3.98
  224   227   0 #   26 | ....>C:..27_:[.DC]C-----G[.DG]:...2_:D<....   0.70   0.08  13.79   8.87  -3.45
  225   226   0 #   27 | ....>C:..28_:[.DT]T-----A[.DA]:...1_:D<....   0.32   0.23  16.73   8.85  -3.38
##### Base-pair criteria used:     4.00     0.00    15.00     2.50    65.00     4.50     7.80 [ O N]
##### 0 non-Watson-Crick base-pairs, and 2 helices (0 isolated bps)
##### Helix #1 (11): 1 - 11
##### Helix #2 (16): 12 - 27
29
FAQs / some questions about find_pair?
« Last post by sli on January 02, 2018, 02:01:25 am »
Dear Dr. Lu
        I want to get DNA structure's information  from a pdb file of DNA-protein complex.when I use 'find_pair' program , the mismatched base pairs which one base is completely flipping are default deleted.  My object is collect the size of the roll angle of the mismatched base pair. Due to my.bps file is lack of the mismatched base pair,when I use 'analyze my.bps' to generate 'bp_step.par', there are not  the mismatched base pairs information. I referenced the method of ' How to fix missing (superfluous) base pairs identified by find_pair?'  .But I still  not solve my problem. Could you give me some suggestions? Thank you!
30
General discussions (Q&As) / Re: Problems using 'Analyze'
« Last post by xiangjun on December 23, 2017, 09:42:01 am »
Hi Ellia,

You need to run "find_pair" first to prepare pairing info for "analyze" to work out the parameters, as shown in the command-line help message:

Code: [Select]
INPUT
        given a PDB file "sample.pdb", the input to analyze can be most
        conveniently generated with the utility program find_pair:
        find_pair sample.pdb sample.inp
        an explicit input file (including 'stdin') must be specified.
EXAMPLES
        analyze sample.inp
        analyze sample1.inp sample2.inp sample3.inp
        find_pair sample.pdb stdout | analyze stdin
        find_pair sample.pdb stdout | analyze -c stdin

In other words, this is a two-step process. Using 355d as an example, you need to do the following:

Code: [Select]
find_pair 355d.pdb 355d.inp
analyze 355d.inp

HTH,

Xiang-Jun
Pages: 1 2 [3] 4 5 ... 10

Created and maintained by Dr. Xiang-Jun Lu [律祥俊], Principal Investigator of the NIH grant R01GM096889
Dr. Lu is currently affiliated with the Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.