Recent Posts

21

FAQs / Re: Where to download x3DNA

« Last post by peaters on January 30, 2024, 03:35:27 pm »

Hello, I've been registered many years ago with my academic account email address but now I can't see the download page.

Many thanks.
Petr

22

RNA structures (DSSR) / Re: How to look for abasic site using DSSR

« Last post by xiangjun on November 27, 2023, 11:54:06 am »

For PDB entry: 1FZL


x3dna-dssr -v

Code: [Select]

******************************************************************
           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
******************************************************************

x3dna-dssr -i=1FZL.pdb

Code: [Select]

   1  C ( A.DC1   0.012  anti,~C2'-endo,BI,non-stack,canonical,helix-end,stem-end,coaxial-stack
   2  A ( A.DA2   0.020  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   3  C ( A.DC3   0.007  anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack
   4  A ( A.DA4   0.018  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   5  A ( A.DA5   0.015  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   6  A ( A.DA6   0.015  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
   7  C ( A.DC7   0.009  anti,~C2'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack
   8  A ( A.DA8   0.013  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop
   9  ? . A.PYP9  ---    modified,~C2'-endo,BI,non-stack,internal-loop
  10  G ( A.DG10  0.013  anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop

more dssr-torsions.txt

Code: [Select]

          nt               alpha    beta   gamma   delta  epsilon   zeta     e-z        chi            phase-angle   sugar-type    ssZp     Dp    splay
 1     C A.DC1               ---     ---    59.6   143.0  -178.2   -98.9    -79(BI)   -112.1(anti)   162.0(C2'-endo) ~C2'-endo     1.99    2.26   16.42
 2     A A.DA2             -92.0  -166.3    54.8   121.4   179.5   -87.3    -93(BI)   -112.9(anti)   143.5(C1'-exo)  ~C2'-endo     1.97    2.07   18.44
 3     C A.DC3             -62.7   166.0    58.6   144.3  -166.0  -165.5     -1(--)    -85.4(anti)   156.7(C2'-endo) ~C2'-endo     2.70    2.79   25.63
 4     A A.DA4             -75.7  -177.0    60.4   153.3  -175.3   -78.8    -97(BI)   -110.7(anti)   185.3(C3'-exo)  ~C2'-endo     1.72    1.82   18.57
 5     A A.DA5             -80.9   172.3    59.3   107.1  -166.5   -94.1    -72(BI)   -126.1(anti)   120.9(C1'-exo)  ~C2'-endo     2.48    2.58   18.91
 6     A A.DA6             -74.4   171.8    59.7   120.9   179.8   -99.1    -81(BI)   -120.3(anti)   134.2(C1'-exo)  ~C2'-endo     2.37    2.43   16.58
 7     C A.DC7             -74.1  -176.0    59.0   149.2  -164.1  -146.5    -18(--)    -93.5(anti)   168.5(C2'-endo) ~C2'-endo     2.04    2.06   24.91
 8     A A.DA8             -74.9   176.5    57.1   147.6  -173.6  -100.2    -73(BI)   -120.0(anti)   175.2(C2'-endo) ~C2'-endo      ---     ---     ---
 9     ? A.PYP9            -63.0   175.7    62.6   135.3  -178.2   -77.7   -101(BI)      ---         151.8(C2'-endo) ~C2'-endo      ---     ---     ---
 10    G A.DG10            -84.6   171.5    59.9   122.1  -176.2  -130.1    -46(BI)   -112.0(anti)   133.5(C1'-exo)  ~C2'-endo     2.63    2.71   21.35


23

RNA structures (DSSR) / Re: How to look for abasic site using DSSR

« Last post by kazi956 on November 27, 2023, 11:26:41 am »

Hello, for instance, in PDB 1FZL, there is an abasic site, and the residue is a modified nucleotide with the resname PYP (pyrene deoxyriboside). X3DNA is not recognizing that residue. However, I see that for residue 3DR (on chain B), where only the sugar-phosphate backbone is present, x3dna is recognizing that and computing backbone torsions. Is there any way to compute backbone torsions for non-standard residues like PYP? Thank you!

24

RNA structures (DSSR) / Re: How to look for abasic site using DSSR

« Last post by xiangjun on November 27, 2023, 10:14:42 am »

2.  Be specific with your questions; provide a minimal, reproducible
        example if possible; use attachments where appropriate.

25

RNA structures (DSSR) / Re: How to look for abasic site using DSSR

« Last post by kazi956 on November 27, 2023, 09:58:01 am »

Hi Honglue,

I've added an option --abasic to DSSR to take abasic sites as nucleotides, as long as main-chain backbone atoms are preserved: P, O5', C5', C4', C3', and O3'. Quick tests on 1l2c and 1l2d show that this new DSSR feature is working as designed (e.g., C.HPD18 is listed in an internal loop). Understandably, the abasic nucleotides won't be involved in base pairing and stacking interactions.

The DSSR on the download page (still labeled v1.6.8-2017mar28) has been updated. Have a try and report back if it solves your problem.

Xiang-Jun

Hi, I am trying to use --abasic command (./x3dna-dssr --abasic -i=test.pdb) on version 1.9.8(2019Oct16), but it's not recognizing the abasic site even if I have P, O5', C5', C4', and C3' atoms. Wondering if --abasic works properly only on the DSSR v1.7.2-2017nov20 release; if so, how can I download the older version? Thank you! 

26

RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?

« Last post by xiangjun on November 25, 2023, 12:01:52 am »

Hi,

Thanks for using DSSR, and for asking questions with specifics and for your followup.

6 A.A7           A.U16          A-U --           --        cWW  cW-W

Base-pair #6 is Watson-Crick like, but not a WC A-U pair, due to unconventional H-bonding patterns, as detailed below:

       [-153.4(anti) ~C3'-endo lambda=53.9] [-160.2(anti) ~C3'-endo lambda=88.0]
       d(C1'-C1')=10.02 d(N1-N9)=9.09 d(C6-C8)=10.56 tor(C1'-N1-N9-C1')=-7.1
       H-bonds[1]: "N1*O2(carbonyl)[2.91]"
       interBase-angle=12  Simple-bpParams: Shear=-2.57 Stretch=1.35 Buckle=9.9 Propeller=-7.0
       bp-pars: [-2.83   0.63    0.93    11.39   -4.17   30.82]

The DBN notation is for classic 2nd stratucure with WC and G-U wobble pairs.

Best regards,

Xiang-Jun

27

RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?

« Last post by sk on November 24, 2023, 04:54:00 pm »

Ok, I think I understood now.

in dbn we have only Watson-Crick and wobble G–U pairs.

Thanks:)

28

RNA structures (DSSR) / A pair is absent in dot-bracket notation ?

« Last post by sk on November 24, 2023, 12:21:42 pm »

Hello,

when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.

Here is a copy of the output.

Code: [Select]

           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C21          G-C WC          19-XIX    cWW  cW-W
   2 A.G2           A.C20          G-C WC          19-XIX    cWW  cW-W
   3 A.C3           A.G19          C-G WC          19-XIX    cWW  cW-W
   4 A.G4           A.U18          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.U5           A.A17          U-A WC          20-XX     cWW  cW-W
   6 A.A7           A.U16          A-U --          --        cWW  cW-W
   7 A.G8           A.C15          G-C WC          19-XIX    cWW  cW-W
   8 A.G9           A.C14          G-C WC          19-XIX    cWW  cW-W

****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))

****************************************************************************



29

RNA structures (DSSR) / Re: Creation of customized structures using DSSR

« Last post by xiangjun on October 12, 2023, 11:11:25 am »

Also "RNAfitme: a webserver for modeling nucleobase and nucleoside residue conformation in fixed-backbone RNA structures" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2317-9):

Here, we present RNAfitme, a versatile webserver tool for remodeling of nucleobase- and nucleoside residue conformations in the fixed-backbone RNA 3D structures. Our approach makes use of dedicated libraries that define RNA conformational space. They have been built upon torsional angle characteristics of PDB-deposited RNA structures. RNAfitme can be applied to reconstruct full-atom model of RNA from its backbone; remodel user-selected nucleobase/nucleoside residues in a given RNA structure; predict RNA 3D structure based on the sequence and the template of a homologous molecule of the same size; refine RNA 3D model by reducing steric clashes indicated during structure quality assessment. RNAfitme is a publicly available tool with an intuitive interface. It is freely accessible at http://rnafitme.cs.put.poznan.pl/

30

RNA structures (DSSR) / Re: Creation of customized structures using DSSR

« Last post by xiangjun on October 12, 2023, 11:06:59 am »

Have a look at "The proto-Nucleic Acid Builder: a software tool for constructing nucleic acid analogs" (https://academic.oup.com/nar/article/49/1/79/6029180):

"To aid the development of novel XNA polymers and the search for possible pre-RNA candidates, this article presents the proto-Nucleic Acid Builder (https://github.com/GT-NucleicAcids/pnab), an open-source program for modeling nucleic acid analogs with alternative backbones and nucleobases. The torsion-driven conformation search procedure implemented here predicts structures with good accuracy compared to experimental structures, and correctly demonstrates the correlation between the helical structure and the backbone conformation in DNA and RNA."

Please report back how it goes.

Best regards,

Xiang-Jun