Netiquette · Download · News · Gallery · Homepage · DSSR · Web-DSSR · DSSR Manual · Reproduce DSSR · DSSR-Jmol · DSSR-PyMOL · Web-SNAP

Recent Posts

Pages: 1 [2] 3 4 ... 10
11
FAQs / Why my message has been deleted?
« Last post by remba87 on January 30, 2018, 10:12:56 am »
Why my message has been deleted?

it was on how to elongate a pdb structure
12
General discussions (Q&As) / Re: Elongate RNA pdb structure
« Last post by xiangjun on January 30, 2018, 09:48:36 am »
Hi Luca,

Thanks for using 3DNA and for posting your question on the Forum.

I vaguely understand what you want to achieve. Have a look of the following two threads:


It would help if you are specific by using a concrete example.


As a side note, you do not need to post the same question more than once in different sections of the Forum. I’ve removed one of them, and move the remaining one to the more relevant section http://forum.x3dna.org/general-discussions/

Xiang-Jun
13
General discussions (Q&As) / Elongate RNA pdb structure
« Last post by remba87 on January 30, 2018, 05:11:20 am »
Hello,
I would like to elongate some RNA pdb structures from my simulation...
I would like to add some C-G base pair in order to make the molecule longer to simulate the SAXS curves.
I tried to look in the forum, but I did not find anything...
any suggestion?
Thanks for the help

Luca
14
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by xiangjun on January 15, 2018, 01:17:15 pm »
Hi Isaure,

You're welcome. I'm glad that you raised up this issue. As a side note, you could display the secondary structure using VARNA using DSSR-derived dssr-2ndstrs.ct or dssr-2ndstrs.bpseq file (in addition to dssr-2ndstrs.dbn), and you would see the same 'issue'.

In fact, this DBN issue is only one of that many subtle points that are not 'documented'. They are too technical in nature, and too detailed for the majorities of DSSR users. So, for practical considerations, I've decided to address them on a case-by-case base (only) when asked.

Best regards,

Xiang-Jun
15
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by ICdB on January 15, 2018, 12:58:57 pm »
Hi Xiang-Jun,

ok, thanks a lot for your help and your detailed answers. And sorry for missing the warning in output.

Best regards,
Isaure
16
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by xiangjun on January 15, 2018, 12:50:58 pm »
Also, pay attention to DSSR output, as shown below for "4OO8-order1.pdb"

****************************************************************************
Special notes:
   o cross-paired segments in separate chains, be *careful* with .dbn

****************************************************************************
This structure contains *1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.
   o The DSSR-derived dbn may be problematic (see notes above).
17
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by xiangjun on January 15, 2018, 12:48:23 pm »
Hi Isaure,

Thanks for your diagnosis of the reported issue.

Quote
I did some more testing, and found that identical PDB files but for the order of the chains get different results.

This is the expected behavior, and what I thought when I first read your post. When deriving the DBN, DSSR assumes the given structure, as a whole, is as if in a continuous chain. Whenever there is a break (between chains or fragments within a chain), an '&' symbol is introduced. When a structure contains more than one chain, they can be ordered differently. DSSR follows the input order strictly, by design. There are tools available to put the chains in 'canonical' order to remove such false 'pseudoknots'.

Best regards,

Xiang-Jun
18
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by ICdB on January 15, 2018, 12:27:35 pm »
Hi Xiang-Jun,

I use version v1.7.2-2017nov20

I did some more testing, and found that identical PDB files but for the order of the chains get different results. On the two pdb attached, I get this:

Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-order1 nts=234 [whole]
GCCAAGCGCACCTAATTTCC&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((&[[[[[[[[[[[[[[[[[[[[&))))))))))))))))))))((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&]]]]]]]]]]]]]]]]]]]]((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order1-C #1 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
((((((((((((((((((((
>4OO8-order1-F #2 nts=20 2.67(1.05) [chain] DNA
GCCAAGCGCACCTAATTTCC
[[[[[[[[[[[[[[[[[[[[
>4OO8-order1-B #3 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
))))))))))))))))))))((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order1-E #4 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
]]]]]]]]]]]]]]]]]]]]((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).

Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-order2 nts=234 [whole]
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))&((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))
>4OO8-order2-B #1 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order2-C #2 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
>4OO8-order2-E #3 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order2-F #4 nts=20 2.67(1.05) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
19
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by xiangjun on January 15, 2018, 11:22:37 am »
Hi Isaure,

Thanks for your followup. I've run DSSR on your attached 4OO8-noprot.pdb, and got the following:

Code: [Select]
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-noprot nts=236 [whole]
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&CAGCCAAGCGCACCTAATTTCC
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))&((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&..))))))))))))))))))))
>4OO8-noprot-B #1 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-noprot-C #2 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
>4OO8-noprot-E #3 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-noprot-F #4 nts=22 2.61(1.34) [chain] DNA
CAGCCAAGCGCACCTAATTTCC
..))))))))))))))))))))

So I still did not see the problem you reported. What version of DSSR are you using?

Xiang-Jun
20
RNA structures (DSSR) / Re: brackets in DNA-RNA pairing
« Last post by ICdB on January 15, 2018, 11:11:44 am »
Hi Xiang-Jun,

Thanks for your prompt answer.
Sorry for a mistake in my question. I ran the local version on a modified pdb (attached) with only the 2 duplexes (wo. the protein) and wo. the 3 additional nucleotides 5' from chain F. When running dssr online or locally on that pdb, I get the same results : squared / round brackets for the B-C / E-F duplex respectively. 
So now my question is about the difference of treatment of those 2 duplexes.

Thanks again in advance,
Isaure
Pages: 1 [2] 3 4 ... 10

Created and maintained by Dr. Xiang-Jun Lu [律祥俊], Principal Investigator of the NIH grant R01GM096889
Dr. Lu is currently affiliated with the Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.