Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers

Topics - tctcab

Pages: [1]
1
RNA structures (DSSR) / modified nucleotides incorrect.
« on: February 04, 2020, 01:26:15 am »
Hi, Dr. Li,

I've read your post regarding the modified nucleotides issue. https://x3dna.org/highlights/modified-nucleotides-in-the-pdb

However, during my usage, I noticed some modified nucleotides are still incorrect:

PDB: 1ASY_R

output of x3dna-dssr:

UCCGUGAUAGUUPAAuGGuCAGAAUGGGCGCPUGUCgCGUGCCAGAUcGGGGtPCAAUUCCCCGUCGCGGAGCCA

  50  G ( R.G651   0.012  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  51  G ( R.G652   0.011  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack
  52  G ( R.G653   0.013  anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop
  53  t . R.5MU654 0.017  modified,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop
  54  P . R.PSU655 0.011  modified,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor

  55  C ] R.C656   0.019  pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop
  56  A . R.A657   0.010  u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate




the PDB fasta from PDB database:

>1ASY_R
UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA

According to the list in your provided https://x3dna.org/luxfiles/modified-bases-2013oct18.txt

5MU should be U, instead of t, PSU should be u, instead of P

hope this helps.

TC




Pages: [1]

Created and maintained by Dr. Xiang-Jun Lu [律祥俊] (xiangjun@x3dna.org)
The Bussemaker Laboratory at the Department of Biological Sciences, Columbia University.