Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.4 (DSSR Manual) · Homepage

Messages - cllawson

Pages: [1]
1
RNA structures (DSSR) / DSSR eta-base theta-base
« on: January 09, 2021, 09:05:52 am »
Dear Xiangjun, 

Wishing you a Happy New Year! 

I have a request regarding DSSR json output for pseudotorsion angles.  I noticed that when backbone is present but no base has been modelled,  eta-base and theta-base values are listed as 0.0 and 0.0. Could you instead assign "null" as done for other pseudotorsion angles that cannot be calculated?  (e.g. eta for 1st residue in a polymer always shows as "null").  PDB ids where I noticed this issue: 6g4s (no bases deposited for entire structure), and 6sg9 (some residues with bases, others without).  Using: DSSR v1.9.10-2020apr23.

Thanks,

Cathy

2
RNA structures (DSSR) / RNA Journal Covers
« on: July 28, 2020, 02:55:31 pm »
Ha just found this http://docs.x3dna.org/images/3dna-RNA-covers.png
Thank you Xiang-Jun for collating all of the 2019 journal covers I had created using X3DNA/blocview with pymol.
I have been testing out x3dna-dssr --cartoon-block today and it is much easier!
I will be using this great new option for all future NDB requests for covers.  :)

3
w3DNA -- web interface to 3DNA / Re: w3dna server update schedule?
« on: August 09, 2019, 07:42:31 am »
Thanks -- that is good news!

4
w3DNA -- web interface to 3DNA / w3dna server update schedule?
« on: August 08, 2019, 12:12:22 pm »
Hi Xiang-Jun,

I notice that ids for more recently released entries yield the following message from the w3DNA server: Empty or invalid ID, please type in a valid one.  (example: http://www.rcsb.org/structure/6I84).
So I'm wondering:
(1) how often the server is updated?
(2) since you can already analyze uploaded structures on the fly have you thought about enabling option to pull/analyze coordinates for newer PDB entries?

Thanks, Cathy

5
Thank you Xiang-Jun.

Indeed you may continue seeing such images on RNA Journal, with 3DNA/blocview credited, at least through next year  :)

6
Congratulations Shuxiang, Wilma, and Xiangjun  on your new publication and server, looks great!

7
General discussions (Q&As) / Re: x3dna-v2.3 no backbone ribbon
« on: July 31, 2018, 02:51:08 pm »
Thanks for the quick reply.
I don't have MolScript installed so that would explain the issue. 
I did find a relatively easy "workaround" though with pymol-- If I load the file "pmiview1" and have pymol create a cartoon with it, it overlays nicely with the r3d file. 
Thanks also for the tip about  DSSR --blocview option, I'll try that as well.

8
General discussions (Q&As) / Re: x3dna-v2.3 no backbone ribbon
« on: July 31, 2018, 12:36:21 pm »
also, for structures with both protein and nucleic acid, no ribbon is appearing for the protein.

9
General discussions (Q&As) / x3dna-v2.3 no backbone ribbon
« on: July 31, 2018, 12:28:39 pm »
Hi Xiang-Jun,

I have been trying to replicate the images that appear on NDB using your latest x3dna package (v2.3) on Mac OS. 

When i run blocview filename.pdb, I get the message:

cannot find 'render'
no image output; 'blocview.r3d' -- to be fed into render/pymol

Which is fine because I have MacPymol so I can view/snap images of the r3d file. 

However, the images I get do not include the backbone ribbon, even though it seems it should be the default to include it (blocview --help states that --no-ds turns it off), so this seems like a bug.

I've attached an example image.

Thanks in advance for your help!

10
RNA structures (DSSR) / Re: using DSSR ct files for input to VARNA
« on: May 24, 2016, 04:22:30 pm »
Thanks for your quick response. For now will follow your suggestion. It would be great if you could follow up on the issue when you have time.

11
RNA structures (DSSR) / using DSSR ct files for input to VARNA
« on: May 24, 2016, 12:13:00 pm »
Dear Xiang-jun,

I have been looking at using VARNA for creating 2D maps of RNA, following what you showed us when we met a few weeks ago.
For the PDB entry 3RG5 (2 tRNA's in the asymmetric unit), VARNA is readily able to read/display using the .ct file DSSR creates for the whole entry from the cif file,
though the result is displeasing--two overlapped tRNAs.

Wwhen I tried to read in either of the individual chain .ct files VARNA chokes (e.g., java.lang.ArrayIndexOutOfBoundsException: -7). 
I've attached one of the problem ct files, wondering if you have seen this type of issue?

12
Feature requests / Re: change eta-theta range?
« on: April 18, 2014, 05:33:45 pm »
Hi Xiang-Jun,
that was fast! and very helpful. Now easy to make nice plots from the output (attached plot is for 3RG5).
happy holiday!
Cathy

13
Feature requests / Re: change eta-theta range?
« on: April 18, 2014, 03:58:02 pm »
Thanks for your quick reply  :)

--pseudotorsions-360  could be a good choice for the option name.

Not sure about need for evaluating other torsion angles in range 0-360, but a to be on the safe side you could also add the option --alltorsions-360

14
Feature requests / change eta-theta range?
« on: April 18, 2014, 03:25:09 pm »
Hi Xiang-Jun,

For your new program DSSR,  I notice that in the torsion output file the eta, theta, eta', and theta' ranges are -180 to +180, whereas the Pyle group's plots use the range 0 to 360.  With 0-360 for eta and theta (or eta' and theta'), the large helical peak falls nicely near the center, whereas with -180 to +180 the peak is split on the edges.  Could you either change to the default range for output of these pseudotorsions or add an option that allows listing in 0-360 range?

Many thanks,

Cathy

15
RNA structures (DSSR) / Re: DSSR release -- Congratulations!
« on: April 14, 2014, 03:43:33 pm »
Thank you! -- with the password on the downloads page, printing the manual now works fine.

For your amusement I attach an image of the illegible table of contents from my prior failed attempt (via firefox/pdf viewer).


16
RNA structures (DSSR) / Re: DSSR release -- Congratulations!
« on: April 14, 2014, 10:25:23 am »
Hi Xiangjun,
I'm having a trouble printing the DSSR manual.
When I print it from Firefox/PDF view the formatting is corrupted.
When I try to print from Mac/Preview and it is asks for a password.
Can you share the password info with your forum registrants?
Thanks, Cathy

17
RNA structures (DSSR) / DSSR release -- Congratulations!
« on: March 10, 2014, 05:34:39 pm »
Hi Xiang-Jun,
Just downloaded and did a quick test of DSSR today after receiving the notice about it from the "3DNA Forum Team".
Results look great!  Many thanks for creating this and making it available.
Cheers,  Cathy

18
Hi,  just wanted to share an alternate way to extend a reference DNA duplex with straight DNA at both termini. I just did this for the purposes of making a picture, so I didn't really care about matching up residue numbers, just superimposing DNA ends.

as an example, say strand 1 of the reference duplex has the sequence TCGGGCTAGCTAGATTTG. 

(1) Identify the first few (say 4 or 5) nucleotides at the 5' end of the reference duplex strand 1:  TCGGG

(2) Identify the last few (say 4 or 5) nucleotides at the 3' end of the reference duplex strand 1:  ATTTG

(3) build a straight DNA duplex with extension sequence lacking TCGGG + TCGGG. 
e.g.,  ACTGACTGACTGACTGTCGGG

You can use 3DNA or, even easier, use the w3dna server (http://w3dna.rutgers.edu/index.php/rebuild). 

(4) build a second straight DNA duplex with  sequence ATTTG + extension sequence lacking ATTTG.
e.g., ATTTGACTGACTGACTGACTGACTG

(5) load the three duplexes into UCSF Chimera, and use the structure comparison MatchMaker Tool to superpose the ends of the extension DNAs on the original structure (it works by aligning the sequences).   First select strands 1 and 2 of the duplex you want to extend as the reference, then select the 1st extension duplex strands for matching.  Then repeat with the 2nd extension duplex.  Make sure to pick the nucleic acid scoring option.

(6) if needed, trim off some or all of the overlapping bases for the picture.

19
General discussions (Q&As) / error bars in DNA parameters
« on: December 17, 2008, 11:11:27 am »
Dear Xiang-Jun,

 Can you advise the best way to determine or estimate error in parameters such as slide, twist, roll, x-displacement for a given estimated coordinate error?   (in our case refinement programs indicate the coordinate error is ~0.3 Angstroms).

thanks,

Cathy

20
Thanks Xiang-Jun for posting this helpful information.

If I understand correctly now what you wrote above,  the x-displacement value for b.p. step A1-A2 applies to both A1-T1 and A2-T2  (they both have the same x-displacement relative to the local helical axis defined by A1-T1 and A2-T2), and the x-displacement value for b.p. step A2-A3 applies to both A2-T2 and A3-T3 (local helical axis defined by A2-T2 and A3-T3).   Base pair A2-T2 then has two different x-displacement values associated with it, depending on whether the local context includes A1-T1 or A3-T3.

Is this a correct interpretation?

21
My question is how to interpret 3DNA output for local base-pair helical parameters, since they are given in terms of a base-pair step, unlike the output of other programs.  I understand that the minimum local environment needed to define the local parameters is the base-pair step, but I am still a bit confused.

Local base-pair helical parameters
    step       X-disp    Y-disp   h-Rise     Incl.       Tip   h-Twist
   1 CG/CG     -1.27     -0.65      3.09     14.77      5.57     33.94

Are the values listed above defining parameters for the 1st base-pair relative to the 2nd, or the 2nd base-pair relative to the 1st, or is there a different explanation?

thanks,

Cathy Lawson

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University