Messages

1401

General discussions (Q&As) / Re: Base pair step parameters with a missing base pair

« on: May 03, 2011, 11:43:26 pm »

Hi Mithun,

The following info may help:

• 3DNA FAQ "How to fix missing (superfluous) base pairs identified by find_pair?" You may want to upload (as attachment) the 4-mer duplex fragment (residues 96-98 for one strand) and provide the base pairs found with "find_pair". Then we can discuss specifically why some pair is missed or mis-assigned by "find_pair".
• Search the forum using the term "find_pair".
• Since you are using 3DNA for MD simulations, please see the post "Ruby scripts for the analysis of MD simulation trajectories".

HTH,

Xiang-Jun

1402

General discussions (Q&As) / Re: Phi-angle problem?

« on: May 02, 2011, 09:38:24 pm »

Hi Søren,

Thanks for your interest in SCHNAaP/SCHNArP and 3DNA. I am impressed by your diligence in digging into the bottom of seemingly trivial details; in my experience, they are what count the most.

Regarding the definition of the phi-angle, reading El Hassan and Calladine's original JMB paper, and my SCHNAaP/SCHNArP JMB publications would certainly help. However, they are no substitutes of going through a worked example -- that's exactly what I put into Section #5 of the 3DNA user's manual (http://3dna.rutgers.edu:8080/3DNA_v1.5/x3dna.pdf). In 3DNA v2.0 distribution, I extracted that section into a separate file named "tech_details.pdf". For any serious 3DNA users, I strongly suggest them to work through it carefully in order to understand each step thoroughly. If you want to see my SCHNAaP/SCHNArP implementation in ANSI C, please let me know.

I am glad that you "found the problem". Regarding "a typo in the SCHNArP paper equation 21" that confused you, I agree that there is indeed a typo -- thank for bring this issue to me attention:
[pre:2wbo9dyp]T^g_{i+1} = [red:2wbo9dyp]T^T_i[/red:2wbo9dyp] * T^i_{i+1}   -- (21) from the SCHNArP paper
should be
T^g_{i+1} = [red:2wbo9dyp]T^g_i[/red:2wbo9dyp] * T^i_{i+1}[/pre:2wbo9dyp]
 I.e., the [red:2wbo9dyp]red[/red:2wbo9dyp] term should have a superscript [red:2wbo9dyp]g[/red:2wbo9dyp] instead of [red:2wbo9dyp]T[/red:2wbo9dyp]. Note that two terms following the equal sign is the correct order.

There are many subtle details that must be properly accounted for in order to get the correct result. Note that the equations may be derived alternatively in a mathematically equivalent form; this may explain why you have to swap the two right hand terms in equation 21 to solve your puzzle.

HTH,

Xiang-Jun

1403

General discussions (Q&As) / Re: Rebuild DNA from C trace

« on: April 20, 2011, 08:51:14 pm »

Dear Damien,

Thanks so much for sharing your story, and I am glad to know that your problem has been solved with  YASARA. I heard of YASARA before, but did not know that it can be used to build a whole DNA structure with only C trace.

Your question inspired me to think a bit more about the DNA modeling issue starting from a partial C or P trace. I sense the solution must be approximate, and not unique. If I have the luxury to devote more effort to 3DNA than my spare time could afford, I may come up with a geometry-based command-line-driven tool. Of course, if YASARA has solved this problem well enough, why bother to recreate the wheel.

Good luck with your project.

Xiang-Jun

1404

General discussions (Q&As) / Re: Rebuild DNA from C trace

« on: April 15, 2011, 07:08:48 pm »

Hi Damien,

Thanks for posting at the 3DNA forum. Unfortunately, 3DNA (in its current version) cannot rebuild a whole DNA structure from only C4 trace. Off the top of my head, I am not sure of another tool that can perform the task either :oops:. You may have a look of NAB from David Case's lab.

Hope you would post back how it goes, possibly with more background information. Whenever possible, I am always interested in improving 3DNA in ways that make sense to me and helpful to the community.

Xiang-Jun

1405

General discussions (Q&As) / Re: building a ssDNA

« on: April 10, 2011, 12:31:42 pm »

But this dna doesn't have asymmetric ends, while I need to cap it with 5' and 3'. Can you guide me how do make the ends 5', and 3'?

What do you mean "DNA capped with 5' and 3' ends"? Please be specific, illustrated with examples.

Do you see such caps with DNA structures downloaded from PDB/NDB?

Again, I sense this concept may be more related to the requirements of your MD simulations than to 3DNA.

Xiang-Jun

1406

MD simulations / Re: Ruby scripts / where is output file?

« on: April 08, 2011, 07:56:14 pm »

Did you read my reply dated Apr 02? Do you know that the Ruby scripts are built on top of 3DNA -- i.e. you should already have a valid 3DNA (preferably v2.0) installed? When you said that "unfortunately in my output file (my.out) the value of parameter relating to every base pair is the same during trajectory", did you bother to check which base-pair is being repeated, and wondering why that bp specifically, not another one? Without being able to reproducing your problem, I really cannot offer you any concrete suggestion. Please ask a local expert (in Unix) for help. In any event, you have full access to the Ruby scripts to dig to the bottom of the problem.

Also as suggested in my previous reply (Apr 02), please update to the current version [red:3pnrsf1p]v0.5[/red:3pnrsf1p], follow carefully the instructions in the [red:3pnrsf1p]README[/red:3pnrsf1p] file, and report back explicitly what happens. The v0.5 scripts are designed to check more vigorously their prerequisites and complain loudly if the requirements are not met.

HTH,

Xiang-Jun

1407

General discussions (Q&As) / Re: building a ssDNA

« on: April 08, 2011, 07:39:46 pm »

Hi Majid,

Glad to see that with 3DNA v2.0, you can now create single stranded DNA. Regarding the topology file and the error message you referred to, they clearly have nothing to do with 3DNA; I sense they may be related to the Gromacs molecular dynamics package you referred to in your first message of the thread.

HTH,

Xiang-Jun

1408

General discussions (Q&As) / Re: How to determine DNA topology form parameters

« on: April 06, 2011, 09:57:18 pm »

Hi, I am analyzing a protein-DNA complex in which DNA is severely curved. The protein could constrain negative DNA supercoils in vitro and I am trying to find some clues to the structural basis of DNA supercoiling from the parameters of DNA calculated by 3dna (listed as following).

Is it possible to infer whether the supercoils come from DNA unwinding or writhing (e.g., the DNA fragment in nucleosome) from these parameters? If so, how to make it?

Thanks for using 3DNA. Your question "How to determine DNA topology form parameters" seems to be beyond the scope of 3DNA (at least in its current versions). In my understanding, DNA topology is at a "higher" level than can be directly accounted for by the base-pair and dinucleotide structural parameters calculated by 3DNA.

And the DNA has an average h-twist value of 35.29 and thus a h=(360/35.29)=10.20 bp/turn. Does it means that the DNA is over-twisted, since h is less than 10.5 bp/turn?

I would be very cautious in trying to draw any firm conclusion from such a subtle difference in helical twist. For one thing, the widely cited empirical value of 10.5 bp/turn is based on (presumably) B-form DNA in solution. The DNA in your protein-DNA complex is only 8-bp long and is severely curved.

Since you [red:3v097b1n]highlighted in red of twist and h-twist[/red:3v097b1n] in the enclosed 3DNA output file, I think the following two threads in the forum may help clarify confusions 3DNA users often have with the two and other related parameters:

• h-twist vs. twist (Oct 2006)
• local helical parameters interpretation question (Sep 2008)

In connection with DNA supercoiling, there is yet another twist in the twist parameter: please see "Two perspectives on the twist of DNA." by Britton, Olson & Tobias (J Chem Phys. 2009 Dec 28;131(24):245101).

HTH,

Xiang-Jun

[hr:3v097b1n][/hr:3v097b1n]PS: To the extent 3DNA may be useful to you, please consider to update your copy to 3DNA v2.0 -- it is simply a better version than v1.5!

1409

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: April 04, 2011, 09:11:09 pm »

Hi Alpay,

Glad to hear your verification that "the scripts are working nicely". I am well aware of the memory issue you raised. By design, the scripts currently process each and every snapshot of an MD simulation and collect all the parameters along the way. As to how many snapshots can be handled, the answer would obviously depend on computer memory and the size (i.e. no. of bps) of a snapshot. I would imagine the scripts should work well for an MD simulation with 50k snapshots,12 bps each, in a computer with say 4GB memory. As an estimation, the output parameters file for the sample 12 bps/20 snapshots takes 76,926 bytes. With 50k snapshots, the space taken would be  (76,926 / 20) * 50000 = 192,300,000 bytes, which is ~183 MB.

HTH,

Xiang-Jun

1410

MD simulations / Re: Ruby scripts / where is output file?

« on: April 02, 2011, 10:11:49 pm »

I was unable to reproduce your problem where in the output file "the value of parameter relating to every base pair is the same during trajectory".

As a followup of my reply (dated Wed Mar 09, 2011) to your post dated Tue Mar 08, 2011, did you realize that your base-pair file "bpfile.dat" does not match your PDB file "dna.pdb". Specifically, the first two base-pair lines in "bpfile.dat" read as below:

[pre:356ija09]1 [red:356ija09]28[/red:356ija09] 0 # 1 | A:...1_:[DC5]C-----G[DG3]:..26_:A 0.20 0.00 0.05 9.04 -1.30
2 [red:356ija09]27[/red:356ija09] 0 # 2 | A:...2_:[.DA]A-----T[.DT]:..25_:A 0.09 0.05 1.13 9.08 -1.30[/pre:356ija09]
However, your PDB data file "dna.pdb" has only 26 nucleotides. In other words, there are no nucleotides #27 and #28 in your PDB file at all.
[hr:356ija09][/hr:356ija09]
Over the past few weeks, I have used your example and other feedbacks I received to further refine the scripts. Now updated to v0.5, the scripts are much more robust;  they provide sensible error message if requirements are not met (e.g., with unmatched base-pair as in your case). All identified issues have been resolved.

Please have a try and report back how it goes.

HTH,

Xiang-Jun

1411

General discussions (Q&As) / Re: Conversions

« on: March 24, 2011, 09:54:20 pm »

Others and I may help you better if you are specific about the DNA duplexes created with "VMD and RasMol",  e.g., by attaching a sample file. Moreover, what format are those structures in initially? Is it PDB? If so, then why do you need to convert the files between .xyz and .pdb using OpenBabel?

By design, 3DNA only accepts compliant PDB format, as documented clearly in the PDB website. Please see the following two blog posts for more details:

• PDB format, how many variants are there?
• PDB ATOM coordinates record

HTH,

Xiang-Jun

1412

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: March 22, 2011, 09:33:45 pm »

Hi Alpay,

I have updated the Ruby scripts to v0.4 which fixed all the glitches that came to my mind.  Please have a try and report back how it goes.

Xiang-Jun

1413

MD simulations / Re: average values from MD simulations

« on: March 20, 2011, 10:50:35 am »

Hi Ara,

Welcome back.

So I was wondering if 3DNA can give information on which base exactly is fluctuating more causing the opening in the pair ?

No. 3DNA "can give information only on a base pair in this case".

if I can calculate the DNA bending during the simulation time

No.

or I will need to find an average structure of my simulation and calculate the bending of that structure.

It is entirely up to you. Please remember that 3DNA is just a tool set.

See my blog post "Calculation of DNA bending angle " for more information.

HTH,

Xiang-Jun

1414

General discussions (Q&As) / Re: building a ssDNA

« on: March 17, 2011, 10:36:28 pm »

Hi Majid,

Which version of 3DNA are you using? What '[mono:rzqs4j2j][red:rzqs4j2j]find_pair -h[/red:rzqs4j2j][/mono:rzqs4j2j]' gives you? Do you see the text "3DNA v2.0 [June 8, 2008]" at the bottom? If not, you are using a previous version of 3DNA (maybe v1.5), and it is high time to upgrade to v2.0.

The very simple Perl script '[mono:rzqs4j2j]pdb_frag[/mono:rzqs4j2j]' is included as part of 3DNA v2.0, in the [mono:rzqs4j2j]$X3DNA/bin[/mono:rzqs4j2j] directory. It is not documented because I do not think it worths the effort  :wink: -- simply look at the code will reveal everything. Given an opportunity, I will completely refine/extend the utility and then document it, with plenty examples   .

Please note the example I showed you is just an illustration of how single strand DNA model can be built using 3DNA, from the (limited) information you provided. There are a couple of other possibilities to explore as well. For those who really want to get the most of what 3DNA has to offer, the most effective way is to read carefully the 2008 3DNA Nature Protocols paper, and try to reproduce and understand each of the recipes/protocols -- I will be happy to address any issues users may encounter in repeating the results reported in this article.

HTH,

Xiang-Jun

1415

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: March 11, 2011, 07:46:15 pm »

From the error message, I guess you have some setting problems, e.g., mismatch between base-pair file and snapshots, or the snapshot contains unknown nucleotide that needs to be specified in file '[mono:2fyzp058]baselist.dat[/mono:2fyzp058]' etc. Thus, it is likely that no sensible 3DNA output parameters file was generated.

It is always a good idea to try a simple example with only one or two snapshots to verify that everything is set up correctly; afterwards, it is only a timing issue between 100 or one million snapshots.

Depending on user feedbacks, I am planning to refine the scripts to check common pitfalls and output sensible error messages accordingly. The next v0.4 should be much more robust for real world applications.

Xiang-Jun

1416

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: March 10, 2011, 09:29:42 pm »

Hi Alpay,

Thanks for the info. Clearly (but not surprisingly), there are many variants of ensemble-format from different visualization/simulation packages. It is impractical nor desirable for the Ruby scripts to account for each and every such possibility. By design, the scripts deal only the simplest/commonest case where each model/snapshot is delineated by the MODEL/ENDMDL pair, and are directly applicable to the analysis of NMR ensembles from the PDB/NDB. To make this point even clearer, I have added  the following sentence to the release post:

Importantly, for the [mono:2fyxsqwq]-e[/mono:2fyxsqwq] and [mono:2fyxsqwq]-m[/mono:2fyxsqwq] options, each model in the ensemble must be delimited by an MODEL/ENDMDL pair, as clearly documented in the Coordinate Section of the PDB format.

The commonly used ensemble formats are better and easily handled on a case-by-case basis, with the following three choices:

• Ask the original software package creator/maintainer to provide support for the MODEL/ENDMDL format, as it is well-documented in the PDB format.
• Write a purpose-specified script to perform the conversion as needed by the user.
• As time permits and with responsive and knowledgeable collaborators, I will consider to write and integrate conversion scripts into the distribution.

Note that starting with v0.1, the scripts support four options ([mono:2fyxsqwq]-e, -m, -p, -l[/mono:2fyxsqwq]) to allow great flexibility.

HTH,

Xiang-Jun

1417

MD simulations / Re: Ruby scripts / where is output file?

« on: March 09, 2011, 08:31:16 pm »

Since the scripts work (as designed) with the distributed example, yet not in your case,  please verify that your setting is correct. Specifically, make sure that your supplied base-pair file matches the model in your ensemble PDB file.

Please report back how it turns out.

Xiang-Jun

1418

General discussions (Q&As) / Re: building a ssDNA

« on: March 08, 2011, 12:05:59 am »

Hi Majid,

You may want to use '[mono:4xhr4aus]fiber[/mono:4xhr4aus]' to generate a duplex DNA of specific sequence, and then extract only chain A either manually, or with the simple Perl script '[mono:4xhr4aus]pdb_frag[/mono:4xhr4aus]'. Here is an example, [red:4xhr4aus]red[/red:4xhr4aus] text means user input:
[pre:4xhr4aus][red:4xhr4aus]fiber my_seq.pdb[/red:4xhr4aus]
Structure #4; Twist: 36.0 (degrees); Rise: 3.375 (Angstrom)

Input your base sequence with only A,C,G & T:
1. From a data file (complete sequence)
2. From keyboard (enter only the repeating sequence)
Your choice (1 or 2, Dft: 2): [red:4xhr4aus]ENTER[/red:4xhr4aus]    # to use the default option

Repeating unit (Dft: A): [red:4xhr4aus]ACGGGTTTTAAAAACCTTTA[/red:4xhr4aus]    # type your sequence
Repeating unit: ACGGGTTTTAAAAACCTTTA
Number of repeats (Dft: 10):  [red:4xhr4aus]1[/red:4xhr4aus]  # just repeat once of the sequence
# Now use RasMol or whatever your preferred viewer to display the duplex structure.

[red:4xhr4aus]pdb_frag A 1:20 my_seq.pdb my_ssDNA.pdb[/red:4xhr4aus]
# my_ssDNA.pdb may be what you want. Again, display it in RasMol.[/pre:4xhr4aus]
Of course, the above procedure could look cryptic and scary for GUI-driven point-and-click users. However, once you know what you are doing, it is easy to write a script to automate the process to ensure quick and reproducible computational 'experiments'.

Just play around to get more familiar with 3DNA. A good starting point could be to reproduce the reported results in the 2008 3DNA Nature Protocols paper to have a feeling of 3DNA has to offer. Do not hesitate to ask if you have any questions.

Xiang-Jun

1419

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: March 05, 2011, 07:23:40 pm »

Hi Alpay,

As always, thanks for your feedback and suggestions. Now specifically,

After I submitted my reply, I already changed the line to have the snapshots as numbers only in your script.  Still, I think it is better to have the numbers as default. May be in your next version?

Suggestion taken -- now in v0.3, the first column is just the snapshot number, without the [mono:2688raft]model_[/mono:2688raft] prefix.

By distribution calculation I meant in addition to the means, standard deviations you already supply, it would be nice to have BI/BII distributions averaged over the trajectory, histograms of each parameter (per base pair/base pair step and over the whole structure). I know there is no perfect analysis script/program out there, but the more the initial analysis does the better for the end user. It also encourages people to use it more!

Just to clarify, the scripts currently do not provide mean/std etc statistics -- they are intended to be calculated by the users, using R/Matlab/Octave/Excel  etc. Regarding BI/BII classification of backbone, histograms of parameters etc, I am putting them in my to-do list.

One more suggestion: In the simulations there are always end effects. A general practice among MD people is to remove the first and last base pairs from the analysis to reduce these effects in the subsequent analysis. It would be great to have this option available as a choice in the script.

Suggestion taken -- now v0.3 has a new [mono:2688raft][red:2688raft]-e[/red:2688raft][/mono:2688raft] option to accomplish just what you asked. Moreover, the two ends can be asymmetrical, e.g., [mono:2688raft][red:2688raft]-e 1 2[/red:2688raft][/mono:2688raft] to remove the first and the last two bps from the extracted parameter list.

Download v0.3 to have a try, and report back any issues you experience; and of course, any new suggestions!

Xiang-Jun

1420

MD simulations / Re: average values from MD simulations

« on: February 28, 2011, 12:13:19 am »

Hi Ara,

Thanks for using 3DNA, and for posting your question(s) in the forum. I am glad to hear that you found the Ruby scripts useful to your analysis of drug-DNA MD simulations -- at the very least, I take it as yet another user confirmation that the Ruby scripts are working as expected.

I am using the program to analyze drug-DNA MD simulations and would like to plot base pairs vs Twist (or Rise or Roll) values and therefore I would like to find an average of those values for each base pair over the simulation. Does bp_helical or bp_step provide that kind of info? Or I will need to write my own script for that?

Again, since I have no direct MD-simulation experience, my understanding could be incomplete. If I guess it correctly, your MD simulations should include many snapshots. The output file for each parameter (e.g.,[mono:1b7xkmyt]x3dna_md_roll.out[/mono:1b7xkmyt] for Roll) from the Ruby scripts, [mono:1b7xkmyt]x3dna_md.rb/extract_par.rb[/mono:1b7xkmyt], contains tabulated values arranged in a m-by-n matrix, where m is the number of models/snapshots, and n is the number of base-pair steps. As noted in the initial release post, "The output parameter table is intended to be fed into R/Matlab/Octive/Excel etc for statistical analysis or visualization." Specially, I decided deliberately not to calculate mean/std etc statistics, even though it should be straightforward to add them.

On the other hand, the files "bp_helical.par" and "bp_step.par" are from each run of the [mono:1b7xkmyt][red:1b7xkmyt]analyze[/red:1b7xkmyt][/mono:1b7xkmyt] program on a snapshot, i.e., they are from native 3DNA output, and are overwritten each time unless you renamed them. Put another way, these two files are not related to your MD analysis; instead they are intended to be used with the [mono:1b7xkmyt][red:1b7xkmyt]rebuild[/red:1b7xkmyt][/mono:1b7xkmyt] program to construct DNA structures as specified by the parameters.

HTH,

Xiang-Jun

1421

MD simulations / Re: Ruby scripts for the analysis of MD simulation trajector

« on: February 23, 2011, 08:43:14 pm »

Hi Alpay,

I just tested the sample set and they seem to work fine.

Thanks for being the first user to verify that the scripts are working as expected. I'd been expecting feedback from shahabshariati after I revised the scripts to v0.2 following his/her 'bug' report.

I added the [mono:1dzrze8o]-all[/mono:1dzrze8o] option simply because it makes sense to me. As mentioned previously, I have no MD experience. Nevertheless, I am glad to know that this functionality coincides with Curves.

Regarding the next step, what do you mean exactly "to incorporate some distribution calculation"? Some simple statistics, maybe?

Regarding your comment/suggestion,

Instead of printing out model_1, model_2, etc.. We should just have the snapshot numbers, since an MD trajectory tends to have thousands of them.

Do you mean to change the 1st column of each output parameter file from e.g., '[mono:1dzrze8o][red:1dzrze8o]model_10[/red:1dzrze8o][/mono:1dzrze8o]' to '[mono:1dzrze8o][red:1dzrze8o]10[/red:1dzrze8o][/mono:1dzrze8o]'? If that's the case, you can simply change line [mono:1dzrze8o]257[/mono:1dzrze8o] in function [mono:1dzrze8o]write_out_parameters()[/mono:1dzrze8o] of [mono:1dzrze8o]x3dna_md.rb[/mono:1dzrze8o] from
[pre:1dzrze8o]c0 = "model_#{entries[idx]}"[/pre:1dzrze8o]to [pre:1dzrze8o]c0 = entries[idx][/pre:1dzrze8o]
Thanks for your feedback. Please clarify so I can improve the scripts.

Xiang-Jun

1422

General discussions (Q&As) / Re: overlap area of stacked linkers

« on: February 14, 2011, 09:02:50 pm »

As mentioned in the 2003 3DNA NAR paper:

The stacking interactions are quantified in 3DNA by the shared overlap area, in Å2, of closely associated base rings, i.e. the nine‐membered ring of a purine R (A or G) and the six‐membered ring of a pyrimidine Y (C, T or U), projected in the mean base pair plane.

So 3DNA, as is, may not provide a sensible value when a non-standard base ring is involved, such as your 3-ring linker. However, you can have a look of the corresponding step in the "stacking.pdb" file, and write a purpose-specific script to get your job done; after all, mathematically, it is all about getting the intersection of two polygons, and then calculating its area.

If you want to go further along the line with 3DNA, please make your problem specific. By using your case as an example, we may extend 3DNA, or at least provide a use-case, in ways potentially useful to other users.

Xiang-Jun

1423

MD simulations / Re: Ruby scripts / where is output file?

« on: February 12, 2011, 11:57:21 am »

./x3dna_md.rb:94:in `each': no block given (LocalJumpError)

You've helped me catch a 'potential' bug -- after googling for the error message, and checked the code, I believe I have fixed it.

Just for the record, here is an example where the change has been made: ([red:qc42htwt].each.collect[/red:qc42htwt] to [red:qc42htwt].collect[/red:qc42htwt])

Code: [Select]

pars[p] = parmtx.each.collect {|x| x[i]}
----->
pars[p] = parmtx.collect {|x| x[i]}The tricky part is that the error message did not show up in Ruby 1.9.2p0 on Ubuntu Linux (10.04) and 1.8.7 on Mac OS X Snow Leopard where I tested the scripts initially. Apparently, for the new versions of Ruby, [red:qc42htwt].each.collect[/red:qc42htwt] just introduces an extra loop over the list, which does no harm to the result. Put another way, you would not have noticed the 'bug' if you had used Ruby 1.8.7, or 1.9.x.

Download and reinstall the revised script v0.2, and report back what you get; I will be surprised if you still have the same problem  :oops:

As always, I welcome bug reports -- the more, the merrier!

Xiang-Jun

1424

General discussions (Q&As) / Re: Problems with mutations on DNA

« on: February 11, 2011, 08:52:03 pm »

I have just the template structure with the double strand sequence GCGT and I want, for example, to mutate the base pair CG with TA but I haven't found a similar example in the tutorial or in the examples.

Conceivably, there are two ways to do what you want with 3DNA:

• Use the "[mono:2j91smsb]analyze/rebuild[/mono:2j91smsb]" pair, as follows (assuming your PDB file is named [mono:2j91smsb]sample.pdb[/mono:2j91smsb]):
  [pre:2j91smsb]find_pair sample.pdb stdout | analyze
  [red:2j91smsb]# In addition to sample.out file, the above will also generate a text file named "bp_step.par".
  # Manually edit it as you see fit, e.g., change a C-G pair to T-A, and name it "new_step.par"[/red:2j91smsb]
  rebuild -atomic new_step.par sample_new.pdb
  [red:2j91smsb]# Refer to FAQ #5 if you want to build a structure with sugar-phosphate backbone.[/red:2j91smsb][/pre:2j91smsb]
  If you have many mutations to perform, it should be straightforward to write a script to automate the process. The possible issue with this approach is that the sugar-phosphate backbone conformation is approximate, and will certainly be different from what you start with.
  
• For a more general approach where the backbone is kept untouched, see the thread "mutating DNA in DNA protein complex". The problem here is that the procedure is not automated (yet). Three years later, I still have the same question:
  

  ... the possibility of performing base mutations while keeping the backbone unchanged. Given this is such a common and clearly defined function, it is hard to imagine there is no such a handy standalone utility program from so many other resources to get the job done. Am I missing something here?

  I'd consider to write a script to automate the task, if there is still enough interest in this functionality and no other available tools are handy enough for this task.

Alternatively, another tool you could try is mutateNA.pl within MMTSB.

HTH, and I hope to see your feedback.

Xiang-Jun
(added June 5, 2011):
Please see the thread "change one base pair in a double-strand DNA structure file"
where the Perl script mutate_bp and the ANSI C program mutate_bases are introduced.

1425

MD simulations / Re: 3dna.pl - A Perl Script for Parsing 3DNA Output

« on: February 10, 2011, 10:29:25 pm »

As requested, an example of the DCD file (note that it is in binary format!) is attached along with a PDB template.

The data was generated by running 1,000 steps of MD using implicit solvent.

Thank you so much for sharing a sample CHARMM DCD file, and providing an example to illustrate how to use it. Honestly, I am surprised that you did not forget my "request" –– if only more 3DNA users could be as generous and responsive! Active participations from enthusiastic users like you and Alpay certainly help make a difference.

Xiang-Jun