Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage

Messages - xiangjun

Pages: 1 ... 46 47 [48] 49 50 ... 67
1176
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 08, 2013, 04:42:50 pm »
I wholeheartedly welcome bug reports, and this latest is of no exception :). I'll get them fixed shortly -- hopefully by tomorrow. With the next release, the program would be quite robust, I believe.

Have a great weekend.

Xiang-Jun

1177
General discussions (Q&As) / Re: Install 3DNA v2.1 on Windows
« on: March 07, 2013, 09:08:04 pm »
Did you read the post "How to install 3DNA on Linux and Windows?". The last part is about installing 3DNA "On MinGW/MSYS--based Windows".

HTH,

Xiang-Jun

1178
General discussions (Q&As) / Re: plot to show DNA conformation
« on: March 07, 2013, 09:21:25 am »
I'd suggest that you pay attention to the Zp parameter, along with some other more commonly used ones.

Good luck with you research!

Xiang-Jun

1179
General discussions (Q&As) / Re: plot to show DNA conformation
« on: March 06, 2013, 12:28:44 pm »
Hi Harry,

Thanks for posting on the Forum. 3DNA per se does not generate Ramachandran-like plot for DNA or RNA, or any plot of that kind. It calculates various structural parameters that can be plotted using third-party tools. Regarding Ramachandran-like plot for RNA (based on pseudo torsion angles), you may check papers from the Pyle lab.

3DNA v2.1 has a new option "analyze -torsion" to calculate commonly used torsion angles, including the following section:

Code: [Select]
Pseudo (virtual) eta/theta torsion angles:

Note: eta:    C4'(i-1)-P(i)-C4'(i)-P(i+1)
      theta:  P(i)-C4'(i)-P(i+1)-C4'(i+1)

      eta':   C1'(i-1)-P(i)-C1'(i)-P(i+1)
      theta': P(i)-C1'(i)-P(i+1)-C1'(i+1)

      eta":   Borg(i-1)-P(i)-Borg(i)-P(i+1)
      theta": P(i)-Borg(i)-P(i+1)-Borg(i+1)

To follow DNA conformational changes, you may find our 2000 JMB paper titled "A-form conformational motifs in ligand-bound DNA structures" relevant. The work examined a variety of parameters, and found Zp to be the most discriminative between A- and B-form DNAs.

Furthermore, 3DNA v2.1 has a Ruby script x3dna_ensemble that makes analysis of MD simulation trajectories straightforward. We have a new 3DNA JoVE paper in press that provides protocols for such MD analysis.

HTH,

Xiang-Jun

 

1180
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 06, 2013, 12:05:45 pm »
Hi,

All the bugs you reported should have been fixed, and DSSR beta-r02-on-20130306 released. Please have a try and report back how it goes.

As you may notice, I have split the thread from the original DSSR announcement post. I also put the long list of buggy cases reported in your second post into the code tag for easy browsing.

Do not be shy in bringing up more bugs --- the more, the merrier!  :D

Xiang-Jun

1181
RNA structures (DSSR) / Re: Bug report of DSSR beta
« on: March 04, 2013, 02:48:19 pm »
Hi,

Thanks for using DSSR, and reporting back the issues you experienced. I will look into them and release an updated version shortly. Stay tuned  :D

Xiang-Jun

1182
Note added on March 28, 2015: Please visit "DSSR: Dissecting the Spatial Structure of RNA"


As the number of experimentally solved RNA-containing structures grows, it is becoming increasingly important to characterize the geometric features of the molecules consistently and efficiently. Existing RNA bioinformatics tools are fragmented, and suffer in either scope or usability. DSSR, a new 3DNA program for Defining the Secondary Structures of RNA from three-dimensional (3D) coordinates, is designed to streamline the analyses of 3D RNA structures. It consolidates, refines, and significantly extends the functionality of 3DNA for RNA structural analysis.

Starting from an RNA structure in PDB or PDBx/mmCIF format, DSSR employs a set of simple geometric criteria to identify all existent base pairs (bp): either canonical Watson-Crick and wobble pairs or non-canonical pairs with at least one hydrogen bond. The latter pairs may include normal or modified bases, regardless of tautomeric or protonation state. DSSR uses the six standard rigid-body bp parameters (shear, stretch, stagger, propeller, buckle, and opening) to rigorously quantify the spatial disposition of any two interacting bases. Where applicable, the program also denotes a bp by common names, the Saenger classification scheme of 28 H-bonding types, and the Leontis-Westhof nomenclature of 12 basic geometric classes.

DSSR detects multiplets (triplets or higher-order base associations) by searching horizontally in the plane of the associated bp for further H-bonding interactions. The program determines double-helical regions by exploring vertically in the neighborhood of selected bps for base-stacking interactions, regardless of backbone connection (e.g., coaxial stacking of helices). DSSR then identifies hairpin loops, bulges, internal loops, and multi-branch loops (junctions), and recognizes the existence of pseudo-knots. The program outputs RNA secondary structure in dot-bracket notation (dbn) and connect table (.ct) format that can be fed directly into visualization tools (such as VARNA).

DSSR classifies dinucleotide steps into the most common A-, B-, or Z-form double helices, calculates commonly used backbone torsion angles, and assigns the consensus RNA backbone suite names. The program also identifies A-minor interactions, ribose zippers, G quartets, kissing loops, U-turns, and kink-turns. Furthermore, it reports non-pairing interactions (H-bonding or base-stacking) between two nucleotides, and contacts involving phosphate groups.

Currently at version 1.2, DSSR is in a stable and mature state. A simple web interface and a comprehensive user manual are available. Supported by Dr. Robert Hanson, DSSR has recently been integrated into Jmol, a popular molecular graphics program. DSSR-related news and information can be found on the 3DNA homepage. Questions and suggestions are always welcome on the 3DNA forum.

Give DSSR a try, compare it with similar tools in terms of usability, functionality and support, and see the differences!

Current version: DSSR v1.2.5-2015mar19. Release history (in reverse chronological order)



List of users who has helped improve DSSR by reporting bugs, making comments/suggestions etc:

jyvdf3asdg2; kailsen; MarcParisien; jctoledo; Auffinger; febos; acolasanti; hansonr; cllawson; cllawson; Sylverlin

-- Xiang-Jun


Note: please start a new topic with a more specific title; do not post directly below this announcement.


Here are some sample runs (see x3dna-dssr -h for more info),
Code: [Select]
x3dna-dssr -i=1msy.pdb -o=1msy.out  # 27 nts
x3dna-dssr --input=1msy.pdb --output=1msy.out # as as above
x3dna-dssr -i=1ehz.pdb -o=1ehz.out  # tRNA, 76 nts
x3dna-dssr -i=1jj2.pdb -o=1jj2.out  # rRNA, 2876 nts

Example #1: GUAA tetraloop mutant of Sarcin/Ricin domain from E. Coli 23 S rRNA (1msy)

Code: [Select]
Run: x3dna-dssr -i=1msy.pdb -o=1msy.out --non-pair --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1msy.pdb --u-turn --non-pair -o=1msy.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1msy.pdb
    no. of DNA/RNA chains: 1 [A=27]
    no. of nucleotides:    27
    no. of atoms:          685
    no. of waters:         109
    no. of metals:         0

****************************************************************************
List of 13 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.U2647        A.G2673        U-G Wobble      28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble      28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC          19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC          20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC          19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC          19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --          n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --          n/a       tHH  tM+M
   9 A.G2655        A.U2656        G+U Platform    n/a       cSH  cm+M
  10 A.U2656        A.A2665        U-A rHoogsteen  24-XXIV   tWH  tW-M
  11 A.A2657        A.G2664        A-G Sheared     11-XI     tHS  tM-m
  12 A.C2658        A.G2663        C-G WC          19-XIX    cWW  cW-W
  13 A.G2659        A.A2662        G-A Sheared     11-XI     tSH  tm-M

****************************************************************************
List of 1 multiplet
   1 nts=3 GUA A.G2655,A.U2656,A.A2665

****************************************************************************
List of 1 helix
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[1] bps=12
      strand-1 5'-UGCUCCUAUACG-3'
       bp-type    ||||||....|.
      strand-2 3'-GUGAGGCCAGGA-5'
      helix-form  ..AAA..x...
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W
   7 A.U2653        A.C2667        U-C --           n/a       tW.  tW-.
   8 A.A2654        A.C2666        A+C --           n/a       tHH  tM+M
   9 A.U2656        A.A2665        U-A rHoogsteen   24-XXIV   tWH  tW-M
  10 A.A2657        A.G2664        A-G Sheared      11-XI     tHS  tM-m
  11 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W
  12 A.G2659        A.A2662        G-A Sheared      11-XI     tSH  tm-M

****************************************************************************
List of 1 stem
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=6
      strand-1 5'-UGCUCC-3'
       bp-type    ||||||
      strand-2 3'-GUGAGG-5'
      helix-form  ..AAA
   1 A.U2647        A.G2673        U-G Wobble       28-XXVIII cWW  cW-W
   2 A.G2648        A.U2672        G-U Wobble       28-XXVIII cWW  cW-W
   3 A.C2649        A.G2671        C-G WC           19-XIX    cWW  cW-W
   4 A.U2650        A.A2670        U-A WC           20-XX     cWW  cW-W
   5 A.C2651        A.G2669        C-G WC           19-XIX    cWW  cW-W
   6 A.C2652        A.G2668        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.C2658        A.G2663        C-G WC           19-XIX    cWW  cW-W

****************************************************************************
List of 30 non-pairing interactions
   1 A.U2647        A.G2648        stacking: 1.0(0.5)--pm(>>,forward)
   2 A.G2648        A.C2649        stacking: 7.3(4.6)--pm(>>,forward)
   3 A.G2648        A.G2673        stacking: 2.0(0.2)--mm(<>,outward)
   4 A.C2649        A.U2650        stacking: 2.8(1.1)--pm(>>,forward)
   5 A.U2650        A.C2651        stacking: 0.6(0.0)--pm(>>,forward)
   6 A.C2651        A.C2652        stacking: 0.5(0.1)--pm(>>,forward)
   7 A.C2652        A.U2653        stacking: 5.2(2.6)--pm(>>,forward)
   8 A.C2652        A.G2669        stacking: 0.2(0.0)--mm(<>,outward)
   9 A.U2653        A.A2654        stacking: 3.3(2.0)--pp(><,inward) H-bonds[1]: "OP2-O2'(hydroxyl)[2.62]"
  10 A.A2654        A.U2656        stacking: 3.7(1.1)--mm(<>,outward) H-bonds[1]: "O4'*O4'[3.05]"
  11 A.G2655        A.G2664        stacking: 4.4(2.2)--pp(><,inward) H-bonds[1]: "O2'(hydroxyl)-O6(carbonyl)[3.09]"
  12 A.G2655        A.A2665        H-bonds[3]: "N1(imino)-OP2[2.77],N2(amino)-OP2[3.34],N2(amino)-O5'[2.89]"
  13 A.U2656        A.G2664        H-bonds[2]: "OP2-N1(imino)[3.04],OP2-N2(amino)[2.94]"
  14 A.A2657        A.C2658        stacking: 6.7(2.6)--pm(>>,forward)
  15 A.A2657        A.A2665        stacking: 3.7(3.3)--mm(<>,outward)
  16 A.C2658        A.G2659        stacking: 0.4(0.1)--pm(>>,forward)
  17 A.G2659        A.A2661        H-bonds[1]: "O2'(hydroxyl)-N7[2.60]"
  18 A.G2659        A.G2663        stacking: 3.9(1.2)--mm(<>,outward)
  19 A.U2660        A.A2661        stacking: 7.5(4.2)--pm(>>,forward)
  20 A.A2661        A.A2662        stacking: 6.3(4.4)--pm(>>,forward)
  21 A.G2663        A.G2664        stacking: 2.7(0.6)--pm(>>,forward)
  22 A.G2664        A.A2665        H-bonds[1]: "O2'(hydroxyl)-O4'[2.75]"
  23 A.A2665        A.C2666        stacking: 1.6(1.1)--pm(>>,forward)
  24 A.C2666        A.C2667        stacking: 4.3(2.1)--pm(>>,forward)
  25 A.C2667        A.G2668        stacking: 3.1(1.0)--pm(>>,forward)
  26 A.G2668        A.G2669        stacking: 4.3(3.0)--pm(>>,forward)
  27 A.G2669        A.A2670        stacking: 4.3(2.9)--pm(>>,forward)
  28 A.A2670        A.G2671        stacking: 1.5(1.5)--pm(>>,forward)
  29 A.G2671        A.U2672        stacking: 7.4(4.0)--pm(>>,forward)
  30 A.U2672        A.G2673        H-bonds[1]: "O2'(hydroxyl)-O4'[3.37]"

****************************************************************************
List of 4 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=3 UAA A.U2660,A.A2661,A.A2662
   2 nts=4 CUAU A.C2652,A.U2653,A.A2654,A.U2656
   3 nts=4 GGGG A.G2655,A.G2664,A.G2663,A.G2659
   4 nts=6 CAACCG A.C2658,A.A2657,A.A2665,A.C2666,A.C2667,A.G2668

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 1 hairpin loop
   1 hairpin loop: nts=6; [4]; linked by [#-1]
     nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
       nts=4 GUAA A.G2659,A.U2660,A.A2661,A.A2662

****************************************************************************
List of 1 internal loop
   1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#-1]
     nts=13 CUAGUACGGACCG A.C2652,A.U2653,A.A2654,A.G2655,A.U2656,A.A2657,A.C2658,A.G2663,A.G2664,A.A2665,A.C2666,A.C2667,A.G2668
       nts=5 UAGUA A.U2653,A.A2654,A.G2655,A.U2656,A.A2657
       nts=4 GACC A.G2664,A.A2665,A.C2666,A.C2667

****************************************************************************
List of 1 U-turn
   1  A.G2659-A.A2662 H-bonds[2]: "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]" nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1msy nts=27 [whole]
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))
>1msy-A #1 nts=27 [chain] RNA
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-iloops.pdb -- an ensemble of internal loops
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Example #2: The crystal structure of yeast phenylalanine tRNA at 1.93 Å resolution (1ehz)

Code: [Select]
Run: x3dna-dssr -i=1ehz.pdb -o=1ehz.out --po4 --u-turn
****************************************************************************
         DSSR: a software program for Defining the Secondary
         Structures of RNA from three-dimensional coordinates
         v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)

   This program is being actively maintained and developed. As always,
   I greatly appreciate your feedback! Please report all DSSR-related
   issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
   *promptly* to *any questions* posted there.

****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
      'model:' portion is omitted if no model number is available (as
      is often the case for x-ray crystal structures in the PDB). So a
      common example would be B.A1689, meaning adenosine #1689 on
      chain B. One-letter base names for modified nucleotides are put
      in lower case (e.g., 'c' for 5MC). For further information about
      the output notation, please refer to the DSSR User Manual.
      Questions and suggestions are always welcome on the 3DNA Forum.

Command: x3dna-dssr -i=1ehz.pdb --u-turn --po4 -o=1ehz.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1ehz.pdb
    no. of DNA/RNA chains: 1 [A=76]
    no. of nucleotides:    76
    no. of atoms:          1821
    no. of waters:         160
    no. of metals:         9 [Mg=6,Mn=3]

****************************************************************************
List of 11 types of 14 modified nucleotides
      nt    count  list
   1 1MA-a    1    A.1MA58
   2 2MG-g    1    A.2MG10
   3 5MC-c    2    A.5MC40,A.5MC49
   4 5MU-t    1    A.5MU54
   5 7MG-g    1    A.7MG46
   6 H2U-u    2    A.H2U16,A.H2U17
   7 M2G-g    1    A.M2G26
   8 OMC-c    1    A.OMC32
   9 OMG-g    1    A.OMG34
  10 PSU-P    2    A.PSU39,A.PSU55
  11 YYG-g    1    A.YYG37

****************************************************************************
List of 34 base pairs
      nt1            nt2           bp  name        Saenger    LW  DSSR
   1 A.G1           A.C72          G-C WC          19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC          19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC          19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC          20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC          20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC          20-XX     cWW  cW-W
   8 A.U8           A.A14          U-A rHoogsteen  24-XXIV   tWH  tW-M
   9 A.U8           A.A21          U+A --          n/a       tSW  tm+W
  10 A.A9           A.A23          A+A --          02-II     tHH  tM+M
  11 A.2MG10        A.C25          g-C WC          19-XIX    cWW  cW-W
  12 A.2MG10        A.G45          g+G --          n/a       cHS  cM+m
  13 A.C11          A.G24          C-G WC          19-XIX    cWW  cW-W
  14 A.U12          A.A23          U-A WC          20-XX     cWW  cW-W
  15 A.C13          A.G22          C-G WC          19-XIX    cWW  cW-W
  16 A.G15          A.C48          G+C rWC         22-XXII   tWW  tW+W
  17 A.H2U16        A.U59          u+U --          n/a       tSW  tm+W
  18 A.G18          A.PSU55        G+P --          n/a       tWS  tW+m
  19 A.G19          A.C56          G-C WC          19-XIX    cWW  cW-W
  20 A.G22          A.7MG46        G-g --          07-VII    tHW  tM-W
  21 A.M2G26        A.A44          g-A Imino       08-VIII   cWW  cW-W
  22 A.C27          A.G43          C-G WC          19-XIX    cWW  cW-W
  23 A.C28          A.G42          C-G WC          19-XIX    cWW  cW-W
  24 A.A29          A.U41          A-U WC          20-XX     cWW  cW-W
  25 A.G30          A.5MC40        G-c WC          19-XIX    cWW  cW-W
  26 A.A31          A.PSU39        A-P --          n/a       cWW  cW-W
  27 A.OMC32        A.A38          c-A --          n/a       c.W  c.-W
  28 A.U33          A.A36          U-A --          n/a       tSH  tm-M
  29 A.5MC49        A.G65          c-G WC          19-XIX    cWW  cW-W
  30 A.U50          A.A64          U-A WC          20-XX     cWW  cW-W
  31 A.G51          A.C63          G-C WC          19-XIX    cWW  cW-W
  32 A.U52          A.A62          U-A WC          20-XX     cWW  cW-W
  33 A.G53          A.C61          G-C WC          19-XIX    cWW  cW-W
  34 A.5MU54        A.1MA58        t-a rHoogsteen  24-XXIV   tWH  tW-M

****************************************************************************
List of 4 multiplets
   1 nts=3 UAA A.U8,A.A14,A.A21
   2 nts=3 AUA A.A9,A.U12,A.A23
   3 nts=3 gCG A.2MG10,A.C25,A.G45
   4 nts=3 CGg A.C13,A.G22,A.7MG46

****************************************************************************
List of 2 helices
  Note: a helix is defined by base-stacking interactions, regardless of bp
        type and backbone connectivity, and may contain more than one stem.
      helix#number[stems-contained] bps=number-of-base-pairs in the helix
      bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
      helix-form: classification of a dinucleotide step comprising the bp
        above the given designation and the bp that follows it. Types
        include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
        '.' for an unclassified step, and 'x' for a step without a
        continuous backbone.
      --------------------------------------------------------------------
  helix#1[2] bps=15
      strand-1 5'-GCGGAUUcUGUGtPC-3'
       bp-type    ||||||||||||..|
      strand-2 3'-CGCUUAAGACACaGG-5'
      helix-form  AA....xAAAAxx.
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
   8 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   9 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
  10 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
  11 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
  12 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W
  13 A.5MU54        A.1MA58        t-a rHoogsteen   24-XXIV   tWH  tW-M
  14 A.PSU55        A.G18          P+G --           n/a       tSW  tm+W
  15 A.C56          A.G19          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  helix#2[2] bps=15
      strand-1 5'-AAPcUGGAgCUCAGu-3'
       bp-type    ...||||.||||...
      strand-2 3'-UcAGACCgCGAGUCU-5'
      helix-form  x..AAAAxAA.xxx
   1 A.A36          A.U33          A-U --           n/a       tHS  tM-m
   2 A.A38          A.OMC32        A-c --           n/a       cW.  cW-.
   3 A.PSU39        A.A31          P-A --           n/a       cWW  cW-W
   4 A.5MC40        A.G30          c-G WC           19-XIX    cWW  cW-W
   5 A.U41          A.A29          U-A WC           20-XX     cWW  cW-W
   6 A.G42          A.C28          G-C WC           19-XIX    cWW  cW-W
   7 A.G43          A.C27          G-C WC           19-XIX    cWW  cW-W
   8 A.A44          A.M2G26        A-g Imino        08-VIII   cWW  cW-W
   9 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
  10 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
  11 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
  12 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  13 A.A14          A.U8           A-U rHoogsteen   24-XXIV   tHW  tM-W
  14 A.G15          A.C48          G+C rWC          22-XXII   tWW  tW+W
  15 A.H2U16        A.U59          u+U --           n/a       tSW  tm+W

****************************************************************************
List of 4 stems
  Note: a stem is defined as a helix consisting of only canonical WC/wobble
        pairs, with a continuous backbone.
      stem#number[#helix-number containing this stem]
      Other terms are defined as in the above Helix section.
      --------------------------------------------------------------------
  stem#1[#1] bps=7
      strand-1 5'-GCGGAUU-3'
       bp-type    |||||||
      strand-2 3'-CGCUUAA-5'
      helix-form  AA....
   1 A.G1           A.C72          G-C WC           19-XIX    cWW  cW-W
   2 A.C2           A.G71          C-G WC           19-XIX    cWW  cW-W
   3 A.G3           A.C70          G-C WC           19-XIX    cWW  cW-W
   4 A.G4           A.U69          G-U Wobble       28-XXVIII cWW  cW-W
   5 A.A5           A.U68          A-U WC           20-XX     cWW  cW-W
   6 A.U6           A.A67          U-A WC           20-XX     cWW  cW-W
   7 A.U7           A.A66          U-A WC           20-XX     cWW  cW-W
  --------------------------------------------------------------------------
  stem#2[#2] bps=4
      strand-1 5'-gCUC-3'
       bp-type    ||||
      strand-2 3'-CGAG-5'
      helix-form  AA.
   1 A.2MG10        A.C25          g-C WC           19-XIX    cWW  cW-W
   2 A.C11          A.G24          C-G WC           19-XIX    cWW  cW-W
   3 A.U12          A.A23          U-A WC           20-XX     cWW  cW-W
   4 A.C13          A.G22          C-G WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#3[#2] bps=4
      strand-1 5'-CCAG-3'
       bp-type    ||||
      strand-2 3'-GGUc-5'
      helix-form  AAA
   1 A.C27          A.G43          C-G WC           19-XIX    cWW  cW-W
   2 A.C28          A.G42          C-G WC           19-XIX    cWW  cW-W
   3 A.A29          A.U41          A-U WC           20-XX     cWW  cW-W
   4 A.G30          A.5MC40        G-c WC           19-XIX    cWW  cW-W
  --------------------------------------------------------------------------
  stem#4[#1] bps=5
      strand-1 5'-cUGUG-3'
       bp-type    |||||
      strand-2 3'-GACAC-5'
      helix-form  AAAA
   1 A.5MC49        A.G65          c-G WC           19-XIX    cWW  cW-W
   2 A.U50          A.A64          U-A WC           20-XX     cWW  cW-W
   3 A.G51          A.C63          G-C WC           19-XIX    cWW  cW-W
   4 A.U52          A.A62          U-A WC           20-XX     cWW  cW-W
   5 A.G53          A.C61          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 1 isolated WC/wobble pair
  Note: isolated WC/wobble pairs are assigned negative indices to
        differentiate them from the stem numbers, which are positive.
        --------------------------------------------------------------------
[#1]     -1 A.G19          A.C56          G-C WC           19-XIX    cWW  cW-W

****************************************************************************
List of 2 coaxial stacks
   1 Helix#1 contains 2 stems: [#1,#4]
   2 Helix#2 contains 2 stems: [#3,#2]

****************************************************************************
List of 11 stacks
  Note: a stack is an ordered list of nucleotides assembled together via
        base-stacking interactions, regardless of backbone connectivity.
        Stacking interactions within a stem are *not* included.
        --------------------------------------------------------------------
   1 nts=2 Uc A.U7,A.5MC49
   2 nts=2 UC A.U8,A.C13
   3 nts=2 GA A.G65,A.A66
   4 nts=3 CgC A.C25,A.M2G26,A.C27
   5 nts=3 gAC A.7MG46,A.A21,A.C48
   6 nts=3 GtP A.G53,A.5MU54,A.PSU55
   7 nts=4 GACC A.G1,A.A73,A.C74,A.C75
   8 nts=4 GAcU A.G30,A.A31,A.OMC32,A.U33
   9 nts=5 GGGaC A.G19,A.G57,A.G18,A.1MA58,A.C61
  10 nts=7 gAAgAPc A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
  11 nts=9 GAGAGAGUC A.G43,A.A44,A.G45,A.A9,A.G22,A.A14,A.G15,A.U59,A.C60
     -----------------------------------------------------------------------
  Nucleotides not involved in stacking interactions
     nts=4 uGUA A.H2U17,A.G20,A.U47,A.A76

****************************************************************************
Note: for the various types of loops listed below, numbers within the first
      set of brackets are the number of loop nts, and numbers in the second
      set of brackets are the identities of the stems (positive number) or
      isolated WC/wobble pairs (negative numbers) to which they are linked.

****************************************************************************
List of 3 hairpin loops
   1 hairpin loop: nts=10; [8]; linked by [#2]
     nts=10 CAGuuGGGAG A.C13,A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21,A.G22
       nts=8 AGuuGGGA A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21
   2 hairpin loop: nts=11; [9]; linked by [#3]
     nts=11 GAcUgAAgAPc A.G30,A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
       nts=9 AcUgAAgAP A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39
   3 hairpin loop: nts=9; [7]; linked by [#4]
     nts=9 GtPCGaUCC A.G53,A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60,A.C61
       nts=7 tPCGaUC A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60

****************************************************************************
List of 1 junction
   1 4-way junction: nts=16; [2,1,5,0]; linked by [#1,#2,#3,#4]
     nts=16 UUAgCgCGAGgUCcGA A.U7,A.U8,A.A9,A.2MG10,A.C25,A.M2G26,A.C27,A.G43,A.A44,A.G45,A.7MG46,A.U47,A.C48,A.5MC49,A.G65,A.A66
       nts=2 UA A.U8,A.A9
       nts=1 g A.M2G26
       nts=5 AGgUC A.A44,A.G45,A.7MG46,A.U47,A.C48
       nts=0

****************************************************************************
List of 1 non-loop single-stranded segment
   1 nts=4 ACCA A.A73,A.C74,A.C75,A.A76

****************************************************************************
List of 1 kissing loop interaction
   1 isolated-pair #-1 between hairpin loops #1 and #3

****************************************************************************
List of 2 U-turns
   1  A.U33-A.A36 H-bonds[1]: "N3(imino)-OP2[2.80]" nts=6 cUgAAg A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37
   2  A.PSU55-A.1MA58 H-bonds[1]: "N3-OP2[2.77]" nts=6 tPCGaU A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59

****************************************************************************
List of 18 phosphate interactions
   1 A.U7            OP1-hbonds[1]: "MG@A.MG580[2.60]"
   2 A.A9            OP2-hbonds[1]: "N4@A.C13[3.01]"
   3 A.A14           OP2-hbonds[1]: "MG@A.MG580[1.93]"
   4 A.H2U16         OP2-cap: "A.H2U16"
   5 A.G18           OP1-hbonds[1]: "O2'@A.H2U17[2.97]"
   6 A.G19           OP1-hbonds[2]: "N4@A.C60[3.27],MN@A.MN530[2.19]"
   7 A.G20           OP1-hbonds[1]: "MG@A.MG540[2.07]"
   8 A.A21           OP2-hbonds[1]: "MG@A.MG540[2.11]"
   9 A.A23           OP2-hbonds[1]: "N6@A.A9[3.12]"
  10 A.A35           OP2-cap: "A.U33"
  11 A.A36           OP2-hbonds[1]: "N3@A.U33[2.80]"
  12 A.YYG37         OP2-hbonds[1]: "MG@A.MG590[2.53]"
  13 A.C48           OP2-hbonds[1]: "O2'@A.7MG46[3.55]"
  14 A.5MC49         OP1-hbonds[1]: "O2'@A.C48[3.13]" OP2-hbonds[1]: "O2'@A.U7[2.68]"
  15 A.U50           OP1-hbonds[1]: "O2'@A.U47[2.71]"
  16 A.G57           OP2-cap: "A.PSU55"
  17 A.1MA58         OP2-hbonds[1]: "N3@A.PSU55[2.77]"
  18 A.C60           OP1-hbonds[1]: "N4@A.C61[3.12]" OP2-hbonds[1]: "O2'@A.1MA58[2.42]"

****************************************************************************
This structure contains 1-order pseudoknot
   o You may want to run DSSR again with the '--nested' option which removes
     pseudoknots to get a fully nested secondary structure representation.

****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ehz nts=76 [whole]
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
>1ehz-A #1 nts=76 [chain] RNA
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

****************************************************************************
List of 12 additional files
   1 dssr-stems.pdb -- an ensemble of stems
   2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
   3 dssr-pairs.pdb -- an ensemble of base pairs
   4 dssr-multiplets.pdb -- an ensemble of multiplets
   5 dssr-hairpins.pdb -- an ensemble of hairpin loops
   6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch)
   7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
   8 dssr-2ndstrs.ct -- secondary structure in connect table format
   9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
  10 dssr-torsions.txt -- backbone torsion angles and suite names
  11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
  12 dssr-stacks.pdb -- an ensemble of stacks

Note: shown above, the 3-dimensional schematic images (with rectangular base blocks) were created with the 3DNA blocview program to generate .r3d-formatted files that were ray-traced using PyMOL. The 2-dimensional diagrams were produced with VARNA: Visualization Applet for RNA using DSSR-derived base sequence and dot-bracket notation of secondary structure:
Code: [Select]
>1msy-A #1 RNA with 27 nts
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).

>1ehz-A #1 RNA with 76 nts
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGuPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....

1183
Did you read the 3DNA NP08 paper? Pay special attention to recipe #1, Figure 2: "Schematic diagrams of three representative rigid-body parameters"), and recipe #2, Figure 3: "3DNA-generated images of 22-bp DNA duplexes with the same overall 45° curvature per helical turn".

Also, in 3DNA distribution, did you notice the directory $X3DNA/examples/calladine_drew? It contains further details (see the README file) on how to produce such schematics.

HTH,

Xiang-Jun

1184
General discussions (Q&As) / Re: DNA/ RNA fibre model values
« on: March 02, 2013, 12:01:34 pm »
Quote
I would like to known why in fibre models the values of tilt and shift has to be close to zero

The fiber models from 3DNA are based on experimental data, collected from various sources (for details, type "fiber -m"). You observed that in those structures, the values of tilt and shift are close to zero. Note that the fiber models are simplified, averaged, and regular structures. Compared to roll and slide, tilt and shift are normally not as significant in defining DNA or RNA duplex structures. For example, to a first approximation, A- and B-DNA are distinguished by slide and roll, as shown in Figure 4 of the 3DNA NAR03 paper.



To get a better understanding of DNA structures, see Calladine's book titled "Understanding DNA: The Molecule and How it Works".

HTH,

Xiang-Jun

1185
General discussions (Q&As) / Re: dependency on GLIBC_2.14
« on: March 01, 2013, 10:29:50 am »
Hi Asmita,

Thanks for your feedback. Now I have access to a Debian 6 (x86_64) machine from SBGrid, and did the followings:

~ [501] lsb_release -a
No LSB modules are available.
Distributor ID:   Debian
Description:   Debian GNU/Linux 6.0.6 (squeeze)
Release:   6.0.6
Codename:   squeeze

~ [502] uname -a
Linux sbgrid-dev-vm-17 2.6.32-5-amd64 #1 SMP Sun Sep 23 10:07:46 UTC 2012 x86_64 GNU/Linux

~ [503] ldd --version
ldd (Debian EGLIBC 2.11.3-4) 2.11.3
Copyright (C) 2009 Free Software Foundation, Inc.
This is free software; see the source for copying conditions.  There is NO
warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
Written by Roland McGrath and Ulrich Drepper.

bin [514] ./mutate_bases
===========================================================================
NAME
        mutate_bases -- mutate bases, with backbone conformation unchanged
SYNOPSIS
        mutate_bases [OPTIONS] mutinfo pdbfile outfile
DESCRIPTION
        perform in silico base mutations of 3-dimensional nucleic acid
        structures, with two key and unique features: (1) the sugar-
        phosphate backbone conformation is untouched; (2) the base
        reference frame (position and orientation) is reserved, i.e.,
        the mutated structure shares the same base-pair/step
        parameters as the original one.
  ......
AUTHOR
        3DNA v2.1 (c) 2013 Dr. Xiang-Jun Lu (xiangjun@x3dna.org; http://x3dna.org)
===========================================================================

As shown above, the latest 3DNA v2.1 (2013feb22) is working properly on Debian 6.

Recent 3DNA v2.1 Linux 64-bit releases have been compiled on CentOS 5 (x86_64), which has "ldd (GNU libc) 2.5". Moreover, I have just verified that the latest 2013feb22  x86_64 version works on the following settings:
  • Scientific Linux 6; ldd (GNU libc) 2.12
  • Ubuntu 8.04; ldd (GNU libc) 2.7
  • Ubuntu 12.04; ldd (Ubuntu EGLIBC 2.15-0ubuntu10.3) 2.15

Unless I am missing something obvious, you must have been using a previous release of 3DNA v2.1 which was compiled on Ubuntu 12.04. Install the 2013feb22 release of 3DNA v2.1 and report back if that helps.

Does anyone else have such problem with the Linux 64 bit version of 3DNA v2.1 (2013feb22)?

Xiang-Jun

1186
General discussions (Q&As) / Re: dependency on GLIBC_2.14
« on: February 28, 2013, 02:13:07 pm »
Hi Asmita,

Thanks for reporting the problem of running 3DNA v2.1 on Debian. What are your specific Debian settings? What's the output of running "uname -a"? I will look into the issue soon, and your feedback helps in solving the problem.

Xiang-Jun

1187
General discussions (Q&As) / Re: one comment + one question
« on: February 22, 2013, 11:46:49 am »
Hi Leonardo,

Thanks for using 3DNA, and posting your comment & question on the forum. User-feedback is one of the driving forces to make 3DNA a better tool to serve the community.

Quote
1. Comment: the option -single doesn´t work properly, you have to use -s instead.
Since you mentioned to "build up some structures", I guess you mean the fiber -single option. Indeed, you've identified an inconsistency in the command-line documentation vs how the program actually runs. I've fixed the issue, so now you can use -si, -single, -single-strand or -s for the same effect. Please download the updated 3DNA v2.1 release dated 2013feb22.

This is a concrete example how a user like you help improve 3DNA -- thanks!

Quote
2. Stupid question: how I can add the hydrogen atoms to my structure? Maybe there is
    a better way to do it than using for example Avogadro, because if you use this option
    the sistem also add the hydrogen atoms to the backbone.
In addition to what esguerra suggested, you may also try the "Reduce Software for Adding Hydrogens" from the Richardson laboratory.

HTH,

Xiang-Jun

1188
General discussions (Q&As) / Re: Details in Zp(h) definition.
« on: February 20, 2013, 01:33:08 pm »
Hi Mauricio,

Thanks for your nice words about our 3DNA NAR03 paper. We did put lots of efforts to make it up to our satisfaction; the paper went through numerous iterations, some of which I still keep a (hard) copy. The paper got published nearly one year after I left Rutgers. It is a solid piece of work, with details (e.g., analysis of non-cannoical base pairs) yet to be fully appreciated by the community of nucleic acid structures.

Now back to your question regarding Zp vs Zp(h), your assumption is right:

Quote
the only difference between Zp and Zp(h) is that of the election of the reference frame, that is, the middle-frame vs. the local helical axis reference frame.

The Xp(h)/Yp(h)/Zp(h) set was introduced to parallel Xp/Yp/Zp, just as (X-disp, Y-disp, h-Rise, Incl., Tip, h-Twist) vs. (Shift, Slide, Rise, Tilt, Roll, Twist).

You can easily derive the Zp and Zp(h) etc values for each dinucleotide step from files "stacking.pdb" and "hstacking.pdb", respectively. The difference is most obvious for an A-DNA (e.g., 1ih2) than for a B-DNA (355d).

HTH,

Xiang-Jun
 

1189
General discussions (Q&As) / Re: B-Factor values from PDB in output files?
« on: February 19, 2013, 10:58:31 pm »
I have looked into the B-factor issue, and noticed a numerical inconsistency for the sugar moiety. Using the example nucleotide C2 on chain A (A.C2) of PDB entry 1dqh, you reported a mean B-factor for sugar moiety of 30.04.

Quote
As an example, I've included the pair extract from a random structure 1DQH.

For A(C 2) -- (G18)B, the B-factor averages would be:

A   C2   All Nucleobase Average   28.6875
      Base moeity average   24.095
      Sugar moeity average    30.0375
      Backbone moiety average   33.2125

The atomic records for the A.C2(1dqh) are as below:
ATOM     21  P     C A   2      37.584  10.166  36.231  1.00 35.40           P  
ATOM     22  OP1   C A   2      38.502   9.371  35.370  1.00 37.17           O 
ATOM     23  OP2   C A   2      37.371  11.599  35.951  1.00 34.58           O 
ATOM     24  O5'   C A   2      36.188   9.406  36.193  1.00 33.54           O 
ATOM     25  C5'   C A   2      36.118   7.997  36.285  1.00 32.07           C 
ATOM     26  C4'   C A   2      34.683   7.567  36.457  1.00 30.69           C 
ATOM     27  O4'   C A   2      34.156   8.055  37.727  1.00 29.94           O 
ATOM     28  C3'   C A   2      33.728   8.137  35.431  1.00 30.66           C 
ATOM     29  O3'   C A   2      33.789   7.366  34.249  1.00 31.59           O 
ATOM     30  C2'   C A   2      32.391   7.983  36.148  1.00 28.79           C 
ATOM     31  O2'   C A   2      31.937   6.639  36.197  1.00 29.01           O 
ATOM     32  C1'   C A   2      32.779   8.394  37.563  1.00 27.55           C 

ATOM     33  N1    C A   2      32.625   9.836  37.823  1.00 25.64           N 
ATOM     34  C2    C A   2      31.353  10.331  38.113  1.00 24.78           C 
ATOM     35  O2    C A   2      30.382   9.563  38.052  1.00 23.25           O 
ATOM     36  N3    C A   2      31.210  11.641  38.434  1.00 24.08           N 
ATOM     37  C4    C A   2      32.265  12.446  38.446  1.00 23.49           C 
ATOM     38  N4    C A   2      32.070  13.718  38.781  1.00 22.55           N 
ATOM     39  C5    C A   2      33.573  11.981  38.110  1.00 24.21           C 
ATOM     40  C6    C A   2      33.702  10.676  37.806  1.00 24.76           C 

The sugar moiety (colored red) has actually a mean B-factor of 30.43, which is different from your number (30.04). Any explanation?

Xiang-Jun

1190
MD simulations / Re: Stacking of two neighboring non-base-paired bases
« on: February 19, 2013, 10:03:16 pm »
Reviewing the thread, you would recall that find_pair is not used for your special case. The input file is prepared manually, and then fed to analyze to get the result. It is more likely something is wrong in your for-loop than a bug in 3DNA. If you understand the protocol as we went through, then try to write a for loop that repeats only once to confirm its correctness.

As always, a reproducible example would have made things clear.

Xiang-Jun

1191
General discussions (Q&As) / Re: Building chromosome with fiber
« on: February 18, 2013, 12:07:40 pm »
Hi Nikolay,

Thanks for providing further info. I tried to build a fiber-based structure with 48M bps on my new iMac with 32GM RAM. The fiber program did not exist with the memory allocation error as you saw, but it seems never to finish!

So fiber appears not up to the job, even though in principle it should. Note also that with 48M bps, the PDB format is certainly out of the question. If you really want to go for it, you may try smaller fragments (with the -xml option for the PDBML format) that can be built with fiber, and then assemble them into the whole 48M bps chromosome.

Xiang-Jun

1192
General discussions (Q&As) / Re: Building chromosome with fiber
« on: February 18, 2013, 10:18:38 am »
The error message you reported is related to memory allocation. It is likely that your computer is not up to the task. What are the settings of your computer? How much RAM do you have?

How did you run the fiber program specifically? How many bps does the chromosome have?

If you could provide such details, others may help you identify where the problem is, and possibly come up with a solution.

Xiang-Jun

1193
MD simulations / Re: Stacking of two neighboring non-base-paired bases
« on: February 17, 2013, 11:32:21 am »
This is where programming (scripting) skills come into play. You do not have to do this manually for each of your 25k+ frames, once you have written a purpose-speicifc script to automate the process. You may find it helpful to have a look of the Ruby script x3dna_ensemble and corresponding files under folder lib/.

Alternatively, Curves+ or other tools may better suit your needs.

Xiang-Jun

1194
General discussions (Q&As) / Re: B-Factor values from PDB in output files?
« on: February 13, 2013, 06:24:58 pm »
Thanks for your feedback -- that helps me in making decisions. I could add the new functionality to 3DNA's "analyze" program, or more sensibly, to the new RNA-focused component (DSSR) I am currently working on. I aim to get DSSR (alpha test version) out by the end of the month, or even possibly by next week.

NMR structures in PDB seem to have the b-factor columns filled. Calculating the average values of b-factors regardless structure type would make coding simple and consistent.

Xiang-Jun

1195
General discussions (Q&As) / Re: B-Factor values from PDB in output files?
« on: February 13, 2013, 01:34:02 pm »
Thanks for your feedback.

Just to be sure: by ".outp", you mean the option "find_pair -p"-generated file "allpairs.ana" which is then fed into "analyze"? How about the default setting? i.e., the ".out" file?

I will think more about this request, and I may come up with something. If I decide to go for it, I'd output the B-factor average/occupancy for any input structure, not just crystal structures. Moreover, there would be a new command line option for such info, which is OFF by default to be compatible with previous 3DNA releases.

To help me help you in this endeavor, could you provide (at least) a concrete example with the values you want?

Xiang-Jun


1196
General discussions (Q&As) / Re: pdf files to use with spdbv and Curves+
« on: February 13, 2013, 12:11:28 pm »
It certainly would help if you've included specifics as to how w3DNA-generated PDB files cannot be used with spdbv or Curves+. I guess the issue is due to PDB v2.x atom names used by w3DNA which is still not updated to v2.1 yet. In the current 3DNA release, PDB v3.x atom names are used by default, which should make "spdbv or Curves+" happy.

Please download and install 3DNA v2.1, and report back if that helps. See also the thread "Missing atoms".

HTH,

Xiang-Jun

1197
General discussions (Q&As) / Re: B-Factor values from PDB in output files?
« on: February 12, 2013, 08:48:25 pm »
The B-factor values are currently not included in 3DNA output file(s), and you are the first user to request such info. Where do you think is the appropriate place to put them? And in what format? How about atom occupancy?

Xiang-Jun

1198
Could you be specific on what you mean by adding "the helical axis as a dotted line in the 3dna-generated figures"? As always, a concrete example would help clarify your point.

Fig. 3 (recipe #2) of the 3DNA NP08 paper shows a dotted line contacting bp centers, but I sense that's not what you want. Does the thread "defining a local helix axis" help?

Xiang-Jun

1199
MD simulations / Re: Stacking of two neighboring non-base-paired bases
« on: January 28, 2013, 11:07:30 am »
Upon your request, I've removed "the image of the whole structure". I understand your concern, and good luck with your manuscript!

Xiang-Jun

1200
MD simulations / Re: Stacking of two neighboring non-base-paired bases
« on: January 27, 2013, 11:22:07 pm »
Thanks for providing a PDB file which helps clarify the issue.

The find_pair program is working as designed. For your RNA structure, it identifies two helical regions (see the attached figure below --- [Note added on 2013-01-28: image deleted upon request]):

Code: [Select]
pdb.00001
pdb.out
    2         # duplex
   30         # number of base-pairs
    1    1    # explicit bp numbering/hetero atoms
   31    8  0 #    1 | ....>-:..31_:[.RG]G-----C[.RC]:...8_:-<....  0.23  0.08 16.57  8.85 -3.78
   32    7  0 #    2 | ....>-:..32_:[.RC]C-----G[.RG]:...7_:-<....  0.50  0.23 11.02  8.87 -3.49
   33    6  0 #    3 | ....>-:..33_:[.RA]A-----U[.RU]:...6_:-<....  0.15  0.03  4.87  8.77 -4.55
   34    5  0 #    4 | ....>-:..34_:[.RA]A-----U[.RU]:...5_:-<....  0.14  0.09  6.89  8.85 -4.32
   35    4  0 #    5 | ....>-:..35_:[.RG]G-----C[.RC]:...4_:-<....  0.84  0.37  4.54  8.71 -3.19
   36    3  0 #    6 | ....>-:..36_:[.RC]C-----G[.RG]:...3_:-<....  0.84  0.79 15.85  8.75 -1.79
   37    2  0 #    7 | ....>-:..37_:[.RU]U-**--G[.RG]:...2_:-<....  3.01  0.85 17.27  8.99  2.57
   38   23  0 #    8 | ....>-:..38_:[.RG]G-----C[.RC]:..23_:-<....  0.45  0.30 12.77  8.96 -3.31
   39   22  0 #    9 | ....>-:..39_:[.RG]G-----C[.RC]:..22_:-<....  0.50  0.33 33.29  8.85 -2.19
   42   40  0 #   10 | ....>-:..42_:[.RA]A-**+-G[.RG]:..40_:-<....  7.23  1.99 47.35  7.57 10.57
   43   61  0 #   11 | ....>-:..43_:[.RA]A-**--G[.RG]:..61_:-<....  1.60  0.88 20.41 10.70  1.38
   44   60  0 #   12 | ....>-:..44_:[.RC]C-----G[.RG]:..60_:-<....  0.34  0.04 24.77  8.89 -3.35
   45   59  0 #   13 | ....>-:..45_:[.RA]A-----U[.RU]:..59_:-<....  0.13  0.06 17.54  8.79 -3.87
   46   58  0 #   14 | ....>-:..46_:[.RU]U-----A[.RA]:..58_:-<....  0.11  0.07 12.05  8.78 -4.15
   47   57  0 #   15 | ....>-:..47_:[.RU]U-----A[.RA]:..57_:-<....  0.36  0.34 10.79  8.72 -3.42
   48   55  0 #   16 | ....>-:..48_:[.RC]C-----G[.RG]:..55_:-<....  0.40  0.02 28.47  8.84 -3.15
   49   54  0 #   17 | ....>-:..49_:[.RC]C-----G[.RG]:..54_:-<....  0.53  0.38 22.85  8.85 -2.56
   50   53  9 #   18 x ....>-:..50_:[.RG]G-**--A[.RA]:..53_:-<....  9.64  0.99 16.65  8.51 11.45
   10   73  0 #   19 | ....>-:..10_:[RG5]g-----c[RC3]:..73_:-<....  0.37  0.20 12.89  8.98 -3.58
   11   72  0 #   20 | ....>-:..11_:[.RG]G-----C[.RC]:..72_:-<....  0.97  0.26 20.72  8.78 -2.48
   12   71  0 #   21 | ....>-:..12_:[.RU]U-----A[.RA]:..71_:-<....  0.17  0.04 22.04  9.00 -3.65
   13   70  0 #   22 | ....>-:..13_:[.RC]C-----G[.RG]:..70_:-<....  0.46  0.18 17.81  9.02 -3.30
   14   69  0 #   23 | ....>-:..14_:[.RC]C-----G[.RG]:..69_:-<....  0.52  0.46 10.86  9.01 -3.01
   15   68  0 #   24 | ....>-:..15_:[.RG]G-----C[.RC]:..68_:-<....  0.33  0.29 12.02  8.95 -3.50
   16   67  0 #   25 | ....>-:..16_:[.RC]C-----G[.RG]:..67_:-<....  0.36  0.30 11.63  8.96 -3.45
   17   66  0 #   26 | ....>-:..17_:[.RA]A-----U[.RU]:..66_:-<....  0.18  0.00  4.99  8.79 -4.57
   18   30  0 #   27 | ....>-:..18_:[.RG]G-----C[.RC]:..30_:-<....  0.35  0.07 24.12  8.82 -3.30
   19   29  0 #   28 | ....>-:..19_:[.RC]C-----G[.RG]:..29_:-<....  0.49  0.20 24.09  8.88 -2.91
   20   28  0 #   29 | ....>-:..20_:[.RC]C-----G[.RG]:..28_:-<....  0.73  0.69 13.00  9.01 -2.25
   21   26  0 #   30 | ....>-:..21_:[.RU]U-**+-G[.RG]:..26_:-<....  1.30  0.34 16.05  9.43 -0.22
##### Base-pair criteria used:     4.00     0.00    15.00     2.50    65.00     4.50     7.80 [ O N]
##### 5 non-Watson-Crick base-pairs, and 2 helices (0 isolated bps)
##### Helix #1 (18): 1 - 18  ***broken O3'[i] to P[i+1] linkage***
##### Helix #2 (12): 19 - 30  ***broken O3'[i] to P[i+1] linkage***

G1 and U24 are not paired according to the default criteria. Indeed, as shown below and as mentioned in your initial post, G1 and U24 are stacking instead of pairing.

Quote
I want to analyze two bases in a ribozyme, G1 and U24, neither of which are in any base pairs. I want to track the sliding interaction of these two bases across the total length of my trajectory, so that I can correlate the sliding to various other distances and angles that I measure across the length of the trajectory as well. I can see how one can extract the slide parameter for a base pair step, but I don't understand if and how one can extract the slide parameter for two unpaired bases.


If you insist on finding the relative geometry of G1 to U24, you could play the following trick:
Code: [Select]
find_pair -s pdb.00001 pdb.00001.datThe -s option means to output a list of all nucleotides in the given PDB file. Since you are interested in only G1 vs U24, you can manually edit the above output file pdb.00001.dat to have the following content:

Code: [Select]
pdb.00001
pdb.outs
    1      # single helix
    2      # number of bases
    1    1 # explicit bp numbering/hetero atoms
    1      #     1 ....>-:...1_:[RG5]g
   24      #    24 ....>-:..24_:[.RU]U

Running "analyze pdb.00001.dat", you get in file pdb.outs the following section:
Code: [Select]
****************************************************************************
Local base step parameters
    step       Shift     Slide      Rise      Tilt      Roll     Twist
   1  g/U      -1.95     -2.62      1.18    -29.34    146.33     78.47
****************************************************************************

Try a few frames (snapshots) along your MD simulation trajectories to decide for yourself if that make sense -- certainly this usage is beyond 3DNA's 'normal' application range.

Xiang-Jun


Pages: 1 ... 46 47 [48] 49 50 ... 67

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University