This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.
Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL
· Video Overview · DSSR v2.9.3 (DSSR Manual) · Homepage
Topics - Sruthi0412
Pages: [1]
1
« on: July 19, 2021, 07:29:24 am »
I have an RNA sequence as below:
5'-GUUUUAGAGCUAUGCUGAAAAGCAUAGCUCUAAAAC-3'
In this, the bold region forms a loop. I want to remove the underlined base pairs( adjacent to the loop) and connect the loop to the rest of the system. In this way my system would be shorter. Is it possible to do such removal and fixing using 3DNA? Kindly guide regarding the same.
After removal my system should look like this
5'-GUUUUAGAGCUAUGAAAAUAGCUCUAAAAC-3'
2
« on: November 10, 2020, 02:18:25 pm »
Dear all,
I had a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' in which the CAUA region was changed to DC DA DT DA DNA bases. I ran some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand.
Now I need to superimpose the major representative cluster of the modified RNA simulation with the original unmodified RNA strand to see the changes in interaction. Also the initial unmodified RNA strand interacts with a protein. After superimposition I want to see the change in nucleic acid- amino acid interactions as well.
So I wanted to know if it is possible to this superimposition effectively using x3DNA.
3
« on: September 27, 2020, 03:28:47 pm »
I am beginner in x3dna and wanted to know how to change a few of the RNA sequences in my RNA into DNA sequences. There are 20 nt in my chain and I want the bases 4-8 to be DNA. Could you give some guidelines regarding changing this
Pages: [1]
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University