Topics

1

RNA structures (DSSR) / How the length of the sequence depends on _pdbx_unobs_or_zero_occ_atoms ???

« on: September 04, 2024, 08:45:08 am »

Hello,

I'm trying to understand why dssr says that 4AL5 has 16 nucleotides.

Cif file contains 20 nucleotides UUCACUGCCGUAUAGGCAGC as _entity_poly.pdbx_seq_one_letter_code,
dssr gives only 16 ACUGCCGUAUAGGCAG.

The sequence is explained as

Code: [Select]

loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero

B 2 1   U   1   2   ?   ?   ?   B . n
B 2 2   U   2   3   ?   ?   ?   B . n
B 2 3   C   3   4   4   C   C   B . n
B 2 4   A   4   5   5   A   A   B . n
B 2 5   C   5   6   6   C   C   B . n
B 2 6   U   6   7   7   U   U   B . n
B 2 7   G   7   8   8   G   G   B . n
B 2 8   C   8   9   9   C   C   B . n
B 2 9   C   9   10  10  C   C   B . n
B 2 10  G   10  11  11  G   G   B . n
B 2 11  U   11  12  12  U   U   B . n
B 2 12  A   12  13  13  A   A   B . n
B 2 13  U   13  14  14  U   U   B . n
B 2 14  A   14  15  15  A   A   B . n
B 2 15  G   15  16  16  G   G   B . n
B 2 16  G   16  17  17  G   G   B . n
B 2 17  C   17  18  18  C   C   B . n
B 2 18  A   18  19  19  A   A   B . n
B 2 19  G   19  20  20  G   G   B . n
B 2 20  C   20  21  21  C   C   B . n

If I understand correctly you removed first to lines because _pdbx_poly_seq_scheme.pdb_mon_id  = ? (consequence of _pdbx_unobs_or_zero_occ_residues ? )

But why you should remove C21 and C4 ?
Looks like it has something to do with _pdbx_unobs_or_zero_occ_atoms.

Could you please clarify the situation ?
Thanks in advance.

2

RNA structures (DSSR) / A pair is absent in dot-bracket notation ?

« on: November 24, 2023, 12:21:42 pm »

Hello,

when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.

Here is a copy of the output.

Code: [Select]

           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C21          G-C WC          19-XIX    cWW  cW-W
   2 A.G2           A.C20          G-C WC          19-XIX    cWW  cW-W
   3 A.C3           A.G19          C-G WC          19-XIX    cWW  cW-W
   4 A.G4           A.U18          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.U5           A.A17          U-A WC          20-XX     cWW  cW-W
   6 A.A7           A.U16          A-U --          --        cWW  cW-W
   7 A.G8           A.C15          G-C WC          19-XIX    cWW  cW-W
   8 A.G9           A.C14          G-C WC          19-XIX    cWW  cW-W

****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))

****************************************************************************