Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.3 (DSSR Manual) · Homepage

Messages - himanshu720

Pages: [1]
1
General discussions (Q&As) / Re: DNA Triple Helix Generation
« on: October 22, 2011, 12:19:51 am »
Hello Xiang-Jun,

thanks for immediate reply.

I have taken three DNA strands one double helix, and one single stranded DNA.
->1st strand of Double helix
5'  CCCGAGAGAGAGGGCGGACAGGAC   3'

->complementry strand of 1st strand of double helix
5'  GTCCTGTCCGCCCTCTCTCTCGGG  3'

-> 3rd single strand
5'   GAGAGGGGGGAGAGAGAG  3’

to form triple helix I have to dock 3rd single strand(took as ligand) with the double helix(took as receptor) then I would get the triple helix DNA. This is my assumption.

Problem:
1. DNA-DNA docking is not possible for the larger single strand DNA(taken as ligand). Can you tell why?
2. So I take 3rd single strand just of 3 base-pairs only (GAG) then also it is showing intra-molecular bond between the backbone of the ss-DNA and Nitrogenous bases. But according to the literature there should not be any bond between back-bone of DNA and its own Nitrogenous base, which is shown in the figure.
3. We do simulation that is mainly based on the potential energy. If we ignore these bonds, It would not affect the result efficiency?
4. If my assumption is wrong? Then what should be the idea to form DNA Triple Helix?

Thank you.
Himanshu

2
General discussions (Q&As) / Re: DNA Triple Helix Generation
« on: October 21, 2011, 01:46:21 am »
Hello Xiang-Jun,

Gland to see the immediate reply.

"the ssDNA show intramolecular bonding(backbone and nitrogen bases) which is un-usual"

In the helix of DNA there should not be any bond between the backbone of the DNA and the nitrogen base which is attached to the backbone.
Fig1.png(as attachment) : white ribbon shows Double Helix DNA which target for the docking;
green ribbon shows single strand DNA which is ligand to dock in double stranded DNA. In the green ribbon there is intra-molecular bonding.

Can we ignore those bonds?

thank you.
Himanshu

3
General discussions (Q&As) / DNA Triple Helix Generation
« on: October 20, 2011, 04:31:49 am »
Hello everyone,

I want to generate the DNA Triple Helix. So I docked Double Helix DNA with Single Stranded DNA.
But, the ssDNA show intramolecular bonding(backbone and nitrogen bases) which is un-usual.
Most of the softwares are based on the energy functions.

Can we ignore those bonds ?
Why DNA-DNA docking is not possible for larger size DNA(ligand)?
Is there any rotational bond limitations for DNA-DNA docking?

Any help or suggestions would be greatly appreciated.

Thanks
Himanshu

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University