Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.4 (DSSR Manual) · Homepage

Messages - sk

Pages: [1]
1
Thank you, Xiang-Jun.

2
RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?
« on: September 04, 2024, 04:26:40 pm »
Another question in the same topic.

If I run "x3dna-dssr  --more -i=pdb-data/8SH5.cif" it says

Code: [Select]
...
  17 R.G19          R.C49          G-C WC          19-XIX    cWW  cW-W
       [-155.1(anti) ~C3'-endo lambda=50.2] [-106.9(anti) ~C2'-endo lambda=53.7]
       d(C1'-C1')=10.82 d(N1-N9)=9.00 d(C6-C8)=9.90 tor(C1'-N1-N9-C1')=-11.0
       H-bonds[3]: "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]"
       interBase-angle=8  Simple-bpParams: Shear=-0.21 Stretch=-0.13 Buckle=-2.1 Propeller=-7.6
...

But in dbn, there is no parentheses on these positions (19 and 49). Why? Maybe because of a non-canonical pair have G19-C51 or G19-G22  ?
Do you discard a canonical pair (x,y) if there is a non-canonical one (x,z) with z < y ?

3
Hello,

I'm trying to understand why dssr says that 4AL5 has 16 nucleotides.

Cif file contains 20 nucleotides UUCACUGCCGUAUAGGCAGC as _entity_poly.pdbx_seq_one_letter_code,
dssr gives only 16 ACUGCCGUAUAGGCAG.

The sequence is explained as
Code: [Select]
loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero

B 2 1   U   1   2   ?   ?   ?   B . n
B 2 2   U   2   3   ?   ?   ?   B . n
B 2 3   C   3   4   4   C   C   B . n
B 2 4   A   4   5   5   A   A   B . n
B 2 5   C   5   6   6   C   C   B . n
B 2 6   U   6   7   7   U   U   B . n
B 2 7   G   7   8   8   G   G   B . n
B 2 8   C   8   9   9   C   C   B . n
B 2 9   C   9   10  10  C   C   B . n
B 2 10  G   10  11  11  G   G   B . n
B 2 11  U   11  12  12  U   U   B . n
B 2 12  A   12  13  13  A   A   B . n
B 2 13  U   13  14  14  U   U   B . n
B 2 14  A   14  15  15  A   A   B . n
B 2 15  G   15  16  16  G   G   B . n
B 2 16  G   16  17  17  G   G   B . n
B 2 17  C   17  18  18  C   C   B . n
B 2 18  A   18  19  19  A   A   B . n
B 2 19  G   19  20  20  G   G   B . n
B 2 20  C   20  21  21  C   C   B . n

If I understand correctly you removed first to lines because _pdbx_poly_seq_scheme.pdb_mon_id  = ? (consequence of _pdbx_unobs_or_zero_occ_residues ? )

But why you should remove C21 and C4 ?
Looks like it has something to do with _pdbx_unobs_or_zero_occ_atoms.

Could you please clarify the situation ?
Thanks in advance.

4
RNA structures (DSSR) / Re: A pair is absent in dot-bracket notation ?
« on: November 24, 2023, 04:54:00 pm »
Ok, I think I understood now.

in dbn we have only Watson-Crick and wobble G–U pairs.

Thanks:)

5
RNA structures (DSSR) / A pair is absent in dot-bracket notation ?
« on: November 24, 2023, 12:21:42 pm »
Hello,

when I run "x3dna-dssr -i=17RA.cif --format=mmcif", It says that there are 8 base pairs, but dot-bracket notation contains only 7 open parentheses.
So, my question is why it happens ? Maybe I misunderstood something, I'll be very grateful if you can help me.

Here is a copy of the output.

Code: [Select]
           DSSR: an Integrated Software Tool for
          Dissecting the Spatial Structure of RNA
           v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
     nt1            nt2            bp  name        Saenger   LW   DSSR
   1 A.G1           A.C21          G-C WC          19-XIX    cWW  cW-W
   2 A.G2           A.C20          G-C WC          19-XIX    cWW  cW-W
   3 A.C3           A.G19          C-G WC          19-XIX    cWW  cW-W
   4 A.G4           A.U18          G-U Wobble      28-XXVIII cWW  cW-W
   5 A.U5           A.A17          U-A WC          20-XX     cWW  cW-W
   6 A.A7           A.U16          A-U --          --        cWW  cW-W
   7 A.G8           A.C15          G-C WC          19-XIX    cWW  cW-W
   8 A.G9           A.C14          G-C WC          19-XIX    cWW  cW-W

****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))

****************************************************************************


Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University