Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL
· Video Overview · DSSR v2.7.1 (DSSR Manual) · Homepage
-
Dear all,
I had a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' in which the CAUA region was changed to DC DA DT DA DNA bases. I ran some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand.
Now I need to superimpose the major representative cluster of the modified RNA simulation with the original unmodified RNA strand to see the changes in interaction. Also the initial unmodified RNA strand interacts with a protein. After superimposition I want to see the change in nucleic acid- amino acid interactions as well.
So I wanted to know if it is possible to this superimposition effectively using x3DNA.
-
Hi,
Please provide concrete examples to illustrate unambiguously what you what to achieve.
Best regards,
Xiang-Jun
PS. DSSR 2.x (paid version) contains built-in support for the analysis of MD simulations, and advanced features for DNA/RNA modeling. It can also be used to perform sequence-independent search/fitting employing base as well as backbone structures.
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University