Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.8.1 (DSSR Manual) · Homepage · HIRING!

Author Topic: Dealing with DNA-Protein complexes  (Read 99270 times)

Offline Marcp

  • with-posts
  • *
  • Posts: 6
    • View Profile
Dealing with DNA-Protein complexes
« on: April 28, 2008, 01:06:39 pm »
Hello everyone,

First I'd like to thank the author and maintainer of this very useful and powerful tool, it is one thing to create such a tool but it is way harder to add some real support to it.

My problem is that I'm currently dealing with protein/DNA complexes and I want to modify the structure of the DNA helix within the complex (i.e. keeping the protein structure in the PDB file). When using find_pair and analyze the DNA structure is extracted.

First, I tried to modify the structure obtained this way (by modifying the bp_step.par and then rebuild) but I just couldn't find a way to orient it correctly. When using frame_mol (with the ref_frames.dat generated by the analyze of the protein/DNA complex) the oriented structure does not contain all the bonds (specially between the phosphates).

I hope I was clear enough,

Thank you in advance

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1730
    • View Profile
    • 3DNA homepage
Re: Dealing with DNA-Protein complexes
« Reply #1 on: April 30, 2008, 10:34:46 pm »
Quote
First I'd like to thank the author and maintainer of this very useful and powerful tool, it is one thing to create such a tool but it is way harder to add some real support to it.

Thanks for your kind words about our efforts on 3DNA -- it is indeed to my great gratification to see 3DNA turned into a useful tool in the field of nucleic acid structures :D. Over the years, it is largely to the credit of the world-wide 3DNA user community that is driving its further refinements.

[hr:1kbblvhn][/hr:1kbblvhn]
Modeling DNA structure in a DNA-protein complex (while keeping protein structure unchanged, or RNA tertiary structures model building more generally) is an area where 3DNA can play a more active role. In principle, one can/should keep the DNA backbone conformation as they are except for the part where the base-pair parameters are varied. In this regard, it is essential to set a common reference frame so that the fragments can be properly connected. This process can't be automated in a general sense, so some purpose-specific script would be necessary.

I understand your problem in a general sense. Without seeing a specific example, this is what I would suggest you try:
  • Since a structure from rebuild is always set w.r.t. the 1st base-pair reference frame, you need to firstly set your original DNA-protein complex w.r.t. its first bp frame (using find_pair/frame_mol)
  • Since structures with rebuild use fixed standard backbone conformation, it is not a surprise that backbone connection would be out of normal distance, and thus not connected. By default, a cut-off distance of 4.5 A between O3'(i)--P(i+1) is used (check misc_3dna.par).
HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline Marcp

  • with-posts
  • *
  • Posts: 6
    • View Profile
Re: Dealing with DNA-Protein complexes
« Reply #2 on: May 02, 2008, 06:28:33 am »
Thank you for the reply, now I get it.

Quote
Since a structure from rebuild is always set w.r.t. the 1st base-pair reference frame

Is there any way to change that ? For example, I would like to use the middle pair reference frame.

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1730
    • View Profile
    • 3DNA homepage
Re: Dealing with DNA-Protein complexes
« Reply #3 on: May 03, 2008, 06:46:38 pm »
Quote
Is there any way to change that ? For example, I would like to use the middle pair reference frame.

So, what's your "middle pair reference frame"? How can 3DNA know it in advance?

The 1st reference frame convention of rebuild structure should not be a problem in practice. Just as you can use frame_mol to re-orient your original PDB structure, you can do the same with structures from rebuild. As long as the two structures are in a common frame, they are comparable. And that's point.

For your own exercise and to the benefit of other forum users, I hope you could go through a simple test case, and would be willing to post back the step-by-step procedures you follow. Up to this point, only a few of 3DNA users sum up and post back. Ideally, more 3DNA users would share their experiences.

HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline Marcp

  • with-posts
  • *
  • Posts: 6
    • View Profile
Re: Dealing with DNA-Protein complexes
« Reply #4 on: May 05, 2008, 08:19:33 am »
By "middle reference frame" I was guessing that there would be a way to specify the reference frame (like in frame_mol).

Here is the step by step procedure I followed :

I started from the 1BDT PDB structure (http://http://www.rcsb.org/pdb/explore/explore.do?structureId=1BDT)

A canonical BDNA structure was generated by :

Code: [Select]
fiber -4 1BDT_DNA_Canonical.pdb
Sequence was typed on keyboard : ATAGTAGAGTGCTTCTATCAT

DNA structure parameters were extracted using :

Code: [Select]
find_pair 1BDT_DNA_Canonical.pdb stdout | analyze
In order to modify the DNA structure, some values in the bp_step.par file were changed. Then follows the rebuild procedure :

Code: [Select]
cp bp_step.par bp_step.mut
Modification of several roll and twist values

cp_std BDNA
rebuild -atomic bp_step.mod 1BDT_DNA_mut.pdb

Refer to the attached file for the mutated DNA structure

What I would like to do is replacing the original DNA structure in the 1BDT.pdb file by the DNA structure of 1BDT_DNA_mut.pdb.

I've already tried to use frame_mol using the standard procedure

Code: [Select]
find_pair 1BDT.pdb stdout | analyze
frame_mol -1 ref_frames.dat 1BDT.pdb 1BDT_oriented.pdb

But, as you said, both structures are using the 1st base-pair reference frame. In the case that the DNA structure is bent (like in 1BDT) using the 1st base-pair reference frame is an issue as the DNA structure is overlapping the protein structure. That is why I was asking if one could set another base-pair as reference frame.

Thank you

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1730
    • View Profile
    • 3DNA homepage
Re: Dealing with DNA-Protein complexes
« Reply #5 on: May 06, 2008, 10:40:31 pm »
Thanks for posting your step-by-step procedures: now the issue becomes quite clear.

Quote
But, as you said, both structures are using the 1st base-pair reference frame. In the case that the DNA structure is bent (like in 1BDT) using the 1st base-pair reference frame is an issue as the DNA structure is overlapping the protein structure. That is why I was asking if one could set another base-pair as reference frame.
So the answer to your question is yes: you can set with reference to any bp-frame within the structure just by setting the option such as -6 for the 6th bp. When given two numbers, such as -6,7, the middle frame of bp step 6-7 is used to the orient the structure.
[hr:2fhadkdj][/hr:2fhadkdj]
If you ran "frame_mol -h", you will see:
Code: [Select]
-n1[,n2] base-pair serial number(s) [no spaces around ,]and in the example session,
Code: [Select]
EXAMPLES
        To set the Dickerson-Drew dodecamer CGCGAATTCGCG duplex structure
        (bdl084.pdb) with its minor groove at the middle A6-T7 step facing
        the viewer:
            find_pair bdl084.pdb stdout | analyze
            frame_mol -m -6,7 ref_frames.dat bdl084.pdb bdl084_new.pdb
        Check Examples/Calladine_Drew/ subdirectory for more examples
As I mentioned in my response to your first initial post, in modeling DNA structure from a DNA-protein complex, you could divide the DNA structures into fragments: vary only those that need to change while keeping the other parts as in their original conformation (base + backbone). This would require some manual work, but is doable with the various components in 3DNA, at least in principle. Of course, this approach is purely geometric based, thus the mutated DNA structure could be distorted or has steric-clash with protein.  You need to use molecular graphics based editing tools to fine tune the structure, and/or minimize it using energy calculations.

HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline Marcp

  • with-posts
  • *
  • Posts: 6
    • View Profile
Re: Dealing with DNA-Protein complexes
« Reply #6 on: May 13, 2008, 03:34:17 am »
I have already tried to use frame_mol with the -9,10 option but the result wasn't convincing enough.

Part of the problem is that I always get a
Code: [Select]
broken O3'[i] to P[i+1] linkage error whenever I try to reorient the mutated DNA file (even after misc_3dna.par modification) thus giving a truncated DNA structure. So my question originally was about finding a way to use the 9,10 base pairs reference frame for rebuild.

Otherwise,

Quote
This would require some manual work, but is doable with the various components in 3DNA

I was trying to find a fully automated method, but I will try to find a workaround.

Thank you again for your help and clear instructions.

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University