Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.0 (DSSR Manual) · Homepage · HIRING!

Author Topic: I want to find PDB file  (Read 65358 times)

Offline tnwl124

  • with-posts
  • *
  • Posts: 1
    • View Profile
I want to find PDB file
« on: March 14, 2015, 06:55:12 am »
Dear developer..

Today, I installed DSSR and 3DNA

I want analysis Secondary structure of DNA.

I read the User Manual for DSSR. For using DSSR, PDB file should be prepared.

However, in my case, there are no PDB files, since I used artificial DNA strands. Then, how to fabricate PDB flies (secondary structure of DNA).

Is there any software of web based tools? (I searched Molecular dynamics things.... but I can't find suitable software.)
I want to know one of the secondary structure of sequence "GCGAGCAGACTCCGGTGGAATGAAGGACTCGCAGG CTG ATT CGG TTC ATG CGG ATC CA".

but I couldn't make PDB file.
There are 2D secondary structure builders like mfold, RNA structure, But it cannot be used in x3dna or DSSR

Would you tell me how I find or make the PDB files ?
« Last Edit: March 14, 2015, 07:30:00 am by tnwl124 »

Offline xiangjun

  • Administrator
  • with-posts
  • *****
  • Posts: 1736
    • View Profile
    • 3DNA homepage
Re: I want to find PDB file
« Reply #1 on: March 14, 2015, 10:53:52 am »
Hi tnwl124,

Thanks for your interest in using DSSR and 3DNA. As you are aware, DSSR/3DNA starts from a three-dimensional RNA or DNA structure with atomic coordinates in PDB or PDBx/mmCIF format. DSSR then derives the secondary structure and base sequence (i.e., 3D->2D/1D). You are working in the opposite direction, i.e., 1D->2D->3D.

There are many tools (e.g., mFold, RNAstruture, and the ViennaRNA package) to predict RNA secondary structure from RNA primary sequence. Following that, there are RNA-puzzles where you can find several resources to predict RNA three-dimensional structures. One example is RNAComposer. Note that these tools focus mostly on RNA, you may need to play around with your DNA sequence.

Another thing to keep in mind is that there is no one-to-one correspondance between 1D->2D->3D structures. Even at the secondary structure level, you can get different results from different programs, or different settings of the same program. The same is even more true from 2D to 3D.

HTH,

Xiang-Jun
Dr. Xiang-Jun Lu[律祥俊](xiangjun@x3dna.org)
We are HIRING!
DSSR download from Columbia Technology Ventures

Offline mauricio esguerra

  • with-posts
  • *
  • Posts: 48
    • View Profile
    • http://mesguerra.org
Re: I want to find PDB file
« Reply #2 on: March 14, 2015, 11:30:35 am »
Hi,

Perhaps if what you want to do is build a 3D model knowing that your DNA is double stranded, then you can use:

http://w3dna.rutgers.edu/rebuild/

w3dna is just a web interface to x3dna. So you can achieve the same results using the command line version of the package with the fiber program inside the x3dna package.

For RNA 1D to 3D you could also use the MC-fold / MC-sym pipeline from Francois Major lab at the University of Montreal.

http://www.major.iric.ca/MC-Fold/

Perhaps if you are more specific on the details of your artificial DNA strand, and the context in which it's found, people in the forum can give better help.
What do you mean by artificial DNA strand?
Do you mean to say that the composing nucleotides have chemical modifications?
Is your DNA strand perhaps part of a CRISPR-cas complex, for example?

 

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University