Messages

1

RNA structures (DSSR) / Re: Removing some nucleotides and fixing/reducing the loop in my RNA structure

« on: July 20, 2021, 06:21:06 am »

This is an already existing crystal structure sequence upon which we are going to do some molecular dynamics simulations. The given RNA structure interacts with a protein as well. We are trying to establish the effect in protein dynamics and conformations upon shortening our RNA structure. Experimentally the underlines sequences have been removed and studies have been performed. The computational modelling also should be done in a similar methodology. Therefore I want to know if such removal of basepairs and adjusting the loops is possible, taking an existing crystal structure pdb.
5'-GUUUUAGAGCUAUGCUGAAAAGCAUAGCUCUAAAAC-3'

2

RNA structures (DSSR) / Removing some nucleotides and fixing/reducing the loop in my RNA structure

« on: July 19, 2021, 07:29:24 am »

I have an RNA sequence as below:
5'-GUUUUAGAGCUAUGCUGAAAAGCAUAGCUCUAAAAC-3'

In this, the bold region forms a loop. I want to remove the underlined base pairs( adjacent to the loop) and connect the loop to the rest of the system. In this way my system would be shorter. Is it possible to do such removal and fixing using 3DNA? Kindly guide regarding the same.
After removal my system should look like this

5'-GUUUUAGAGCUAUGAAAAUAGCUCUAAAAC-3'

3

MD simulations / Superimpose representative cluster of a RNA strand after simulation

« on: November 10, 2020, 02:18:25 pm »

Dear all,

 I had a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' in which the CAUA region was changed to DC DA DT DA DNA bases. I ran some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand.
 Now I need to superimpose the major representative cluster of the modified RNA simulation with the original unmodified RNA strand to see the changes in interaction. Also the initial unmodified RNA strand interacts with a protein. After superimposition I want to see the change in nucleic acid- amino acid interactions as well.
 So I wanted to know if it is possible to this superimposition effectively using x3DNA.

4

General discussions (Q&As) / Re: changing some of the RNA sequence of an chain to DNA

« on: September 27, 2020, 06:04:55 pm »

Sorry for not being clear in my first query.
 I have a single strand of RNA with the sequence
5'- GCGCAUAAAGAUGAGACGCG -3' .
I want to change the CAUA region to DNA bases. Basically, I want the sequence to be changed as DC DA DT DA (Nucleotides 4-8) , while all the other nucleotides are the same RNA sequences. I wanted to know if it is possible to do so in x3dna. I want to run some MD simulations on this sequences to observe how well the DNA substitutions can stay within an RNA strand. I am attaching the RNA pdb here.

5

General discussions (Q&As) / changing some of the RNA sequence of an chain to DNA

« on: September 27, 2020, 03:28:47 pm »

I am beginner in x3dna and wanted to know how to change a few of the RNA sequences in my RNA into DNA sequences. There are 20 nt in my chain and I want the bases 4-8 to be DNA. Could you give some guidelines regarding changing this