Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · Homepage · DSSR Manual · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · DSSR Licensing · Video Overview· RNA Covers

Messages - sunil10654

Pages: [1]
1
General discussions (Q&As) / Re: Adding missing residue in PDB file of RNA
« on: February 08, 2017, 11:30:00 am »
Dear xiangjun,

Thanks for your reply and concern.
This is a great platform to use.
Best of luck for your future endeavor.

2
General discussions (Q&As) / Adding missing residue in PDB file of RNA
« on: February 08, 2017, 11:09:32 am »
Hello Everyone,


I have a PDB file for RNA. Co-ordinates of 8 nucleotide residues are missing in the pdb file. I know the missing sequence of residues. I need the co-ordinates of complete RNA sequence. Can I add the missing residue and create a modified PDB file of complete sequence using x3DNA ?


Sequence :  GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAA
UCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGG--(AUGCUUGU)--CCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA

The region in bracket is missing in PDB file.

Requirement : PDB file of complete sequence.
Thanks.

Pages: [1]

Funded by X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids (R24GM153869)

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University