This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.
Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL
· Video Overview · DSSR v2.7.3 (DSSR Manual) · Homepage
Messages - sunil10654
Pages: [1]
1
« on: February 08, 2017, 11:30:00 am »
Dear xiangjun,
Thanks for your reply and concern.
This is a great platform to use.
Best of luck for your future endeavor.
2
« on: February 08, 2017, 11:09:32 am »
Hello Everyone,
I have a PDB file for RNA. Co-ordinates of 8 nucleotide residues are missing in the pdb file. I know the missing sequence of residues. I need the co-ordinates of complete RNA sequence. Can I add the missing residue and create a modified PDB file of complete sequence using x3DNA ?
Sequence : GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAA
UCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGG--(AUGCUUGU)--CCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA
The region in bracket is missing in PDB file.
Requirement : PDB file of complete sequence.
Thanks.
Pages: [1]
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University