Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.7.4 (DSSR Manual) · Homepage

Messages - atyagiaa

Pages: [1]
1
General discussions (Q&As) / Re: construct dna hairpin structure
« on: September 05, 2017, 05:59:50 am »
Thankyou for the reply,

I used the server and obtained RNA structure, now I need to modify this structure to DNA, can 3DNA help me to perform this step.

2
General discussions (Q&As) / construct dna hairpin structure
« on: September 04, 2017, 11:42:05 pm »
Hi,

I read the manual, and i am confused, how to start designing the hairpin structure for following sequence.
 
GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCTCCC
((((((((((((...)))))...........)))))))

 
But, I don't know from where to start, i read the manual and found it confusing to start it.

Please suggest tutorial, any help will be very helpful.

Thanks

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University