Messages

1

RNA structures (DSSR) / Re: discarded nucleotides in json output

« on: March 08, 2018, 05:23:57 pm »

Hi Xiang-Jun,

Thanks a lot for your detailed reply, and for reminding me of the "nts" entry of the json output. That was very useful.

Best,
Isaure

2

RNA structures (DSSR) / discarded nucleotides in json output

« on: March 04, 2018, 08:36:01 am »

Hi,

First, many thanks for your great software suite. It is a real pleasure to work with such complete and convenient outputs for my parsing purposes. I am a strong believer in collaboration in methods development trough connectible building blocs, and it is nice to have others with such view in the RNA-modeling field 

I am building specific structural fragment libraries for RNA docking, and I try to parse dssr json outputs to automatically keep track of my fragments characteristics (2D structure, interactions ...). For this, I need to now which nucleotides were discarded because of e.g. weird geometry. As I see it, a "&" is inserted in the "bseq" entry for chain breaks. But I can't find any indication of if a nucleotide was discarded or the break was already present in the input pdb, and retrieving it by comparing bseq to the input sequence can be ambiguous.
I am considering using the "Summary of structural features of xx nucleotides" in the text output, by running dssr w. and wo. the "--json" option. Is there a dssp option I could use to get the info directly from the json output and avoid double work (as I am analysing thousands of pdb files)?

Thanks in advance for your help,
Isaure C. de Beauchene

PS: I'm using version v1.7.2-2017nov20

3

RNA structures (DSSR) / Re: brackets in DNA-RNA pairing

« on: January 15, 2018, 12:58:57 pm »

Hi Xiang-Jun,

ok, thanks a lot for your help and your detailed answers. And sorry for missing the warning in output.

Best regards,
Isaure

4

RNA structures (DSSR) / Re: brackets in DNA-RNA pairing

« on: January 15, 2018, 12:27:35 pm »

Hi Xiang-Jun,

I use version v1.7.2-2017nov20

I did some more testing, and found that identical PDB files but for the order of the chains get different results. On the two pdb attached, I get this:

Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-order1 nts=234 [whole]
GCCAAGCGCACCTAATTTCC&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((&[[[[[[[[[[[[[[[[[[[[&))))))))))))))))))))((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&]]]]]]]]]]]]]]]]]]]]((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order1-C #1 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
((((((((((((((((((((
>4OO8-order1-F #2 nts=20 2.67(1.05) [chain] DNA
GCCAAGCGCACCTAATTTCC
[[[[[[[[[[[[[[[[[[[[
>4OO8-order1-B #3 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
))))))))))))))))))))((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order1-E #4 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
]]]]]]]]]]]]]]]]]]]]((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).

Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>4OO8-order2 nts=234 [whole]
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC&GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU&GCCAAGCGCACCTAATTTCC
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))&((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).&))))))))))))))))))))
>4OO8-order2-B #1 nts=97 0.32(2.95) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order2-C #2 nts=20 2.66(1.04) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))
>4OO8-order2-E #3 nts=97 0.39(2.98) [chain] RNA
GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU
((((((((((((((((((((((((((..((((....))))....))))))..(((..).)).......((((....)))).((((((...)))))).
>4OO8-order2-F #4 nts=20 2.67(1.05) [chain] DNA
GCCAAGCGCACCTAATTTCC
))))))))))))))))))))

5

RNA structures (DSSR) / Re: brackets in DNA-RNA pairing

« on: January 15, 2018, 11:11:44 am »

Hi Xiang-Jun,

Thanks for your prompt answer.
Sorry for a mistake in my question. I ran the local version on a modified pdb (attached) with only the 2 duplexes (wo. the protein) and wo. the 3 additional nucleotides 5' from chain F. When running dssr online or locally on that pdb, I get the same results : squared / round brackets for the B-C / E-F duplex respectively. 
So now my question is about the difference of treatment of those 2 duplexes.

Thanks again in advance,
Isaure

6

RNA structures (DSSR) / brackets in DNA-RNA pairing

« on: January 15, 2018, 10:19:45 am »

Hi,

I ran dssr locally on PDB 4OO8, which contains 2 symmetrical copies of a RNA-DNA duplex, made of chains E-F and B-C. The only difference in the 2 duplexes is 3 additional bases in 5' of the DNA chain.
However, the secondary structure given for each duplex is different:

for DNA - RNA:
chain_C['sstr'], chain_B['sstr'] =  '[[[[[[[[[[[[[[[[[[[[',  ']]]]]]]]]]]]]]]]]]]]'
chain_F['sstr'], chain_E['sstr'] = '((((((((((((((((((((' , '))))))))))))))))))))'

When running dssr on http://jmol.x3dna.org/, the secondary structure is identical for the 2 duplexes (with round brackets).
So what is the meaning of the squared brackets in the local version?

Thanks in advance,
Isaure