1
General discussions (Q&As) / Re: rotate_mol rotfile.dat
« on: June 13, 2008, 04:12:26 am »
Thank you and good luck for 2.0
This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.
Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.8.1 (DSSR Manual) · Homepage · HIRING!
broken O3'[i] to P[i+1] linkage error whenever I try to reorient the mutated DNA file (even after misc_3dna.par modification) thus giving a truncated DNA structure. So my question originally was about finding a way to use the 9,10 base pairs reference frame for rebuild.This would require some manual work, but is doable with the various components in 3DNA
fiber -4 1BDT_DNA_Canonical.pdb
Sequence was typed on keyboard : ATAGTAGAGTGCTTCTATCATfind_pair 1BDT_DNA_Canonical.pdb stdout | analyzecp bp_step.par bp_step.mut
Modification of several roll and twist values
cp_std BDNA
rebuild -atomic bp_step.mod 1BDT_DNA_mut.pdb
Refer to the attached file for the mutated DNA structure
find_pair 1BDT.pdb stdout | analyze
frame_mol -1 ref_frames.dat 1BDT.pdb 1BDT_oriented.pdbSince a structure from rebuild is always set w.r.t. the 1st base-pair reference frame
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University