Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.8.1 (DSSR Manual) · Homepage · HIRING!

Messages - Marcp

Pages: [1]
1
General discussions (Q&As) / Re: rotate_mol rotfile.dat
« on: June 13, 2008, 04:12:26 am »
Thank you and good luck for 2.0

2
General discussions (Q&As) / rotate_mol rotfile.dat
« on: June 10, 2008, 05:13:07 am »
Hello,

The rotate_mol program can take as input a data file containing a Transformation Matrix (rotmat.dat in the help displayed on screen), but what is the standard of this particular file ? (What is the size of the matrix, etc ...)

3
General discussions (Q&As) / Re: Dealing with DNA-Protein complexes
« on: May 13, 2008, 03:34:17 am »
I have already tried to use frame_mol with the -9,10 option but the result wasn't convincing enough.

Part of the problem is that I always get a
Code: [Select]
broken O3'[i] to P[i+1] linkage error whenever I try to reorient the mutated DNA file (even after misc_3dna.par modification) thus giving a truncated DNA structure. So my question originally was about finding a way to use the 9,10 base pairs reference frame for rebuild.

Otherwise,

Quote
This would require some manual work, but is doable with the various components in 3DNA

I was trying to find a fully automated method, but I will try to find a workaround.

Thank you again for your help and clear instructions.

4
General discussions (Q&As) / Re: Dealing with DNA-Protein complexes
« on: May 05, 2008, 08:19:33 am »
By "middle reference frame" I was guessing that there would be a way to specify the reference frame (like in frame_mol).

Here is the step by step procedure I followed :

I started from the 1BDT PDB structure (http://http://www.rcsb.org/pdb/explore/explore.do?structureId=1BDT)

A canonical BDNA structure was generated by :

Code: [Select]
fiber -4 1BDT_DNA_Canonical.pdb
Sequence was typed on keyboard : ATAGTAGAGTGCTTCTATCAT

DNA structure parameters were extracted using :

Code: [Select]
find_pair 1BDT_DNA_Canonical.pdb stdout | analyze
In order to modify the DNA structure, some values in the bp_step.par file were changed. Then follows the rebuild procedure :

Code: [Select]
cp bp_step.par bp_step.mut
Modification of several roll and twist values

cp_std BDNA
rebuild -atomic bp_step.mod 1BDT_DNA_mut.pdb

Refer to the attached file for the mutated DNA structure

What I would like to do is replacing the original DNA structure in the 1BDT.pdb file by the DNA structure of 1BDT_DNA_mut.pdb.

I've already tried to use frame_mol using the standard procedure

Code: [Select]
find_pair 1BDT.pdb stdout | analyze
frame_mol -1 ref_frames.dat 1BDT.pdb 1BDT_oriented.pdb

But, as you said, both structures are using the 1st base-pair reference frame. In the case that the DNA structure is bent (like in 1BDT) using the 1st base-pair reference frame is an issue as the DNA structure is overlapping the protein structure. That is why I was asking if one could set another base-pair as reference frame.

Thank you

5
General discussions (Q&As) / Re: Dealing with DNA-Protein complexes
« on: May 02, 2008, 06:28:33 am »
Thank you for the reply, now I get it.

Quote
Since a structure from rebuild is always set w.r.t. the 1st base-pair reference frame

Is there any way to change that ? For example, I would like to use the middle pair reference frame.

6
General discussions (Q&As) / Dealing with DNA-Protein complexes
« on: April 28, 2008, 01:06:39 pm »
Hello everyone,

First I'd like to thank the author and maintainer of this very useful and powerful tool, it is one thing to create such a tool but it is way harder to add some real support to it.

My problem is that I'm currently dealing with protein/DNA complexes and I want to modify the structure of the DNA helix within the complex (i.e. keeping the protein structure in the PDB file). When using find_pair and analyze the DNA structure is extracted.

First, I tried to modify the structure obtained this way (by modifying the bp_step.par and then rebuild) but I just couldn't find a way to orient it correctly. When using frame_mol (with the ref_frames.dat generated by the analyze of the protein/DNA complex) the oriented structure does not contain all the bonds (specially between the phosphates).

I hope I was clear enough,

Thank you in advance

Pages: [1]

Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids

Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University